ID: 993561336

View in Genome Browser
Species Human (GRCh38)
Location 5:89414508-89414530
Sequence AGCCAAAGGTTGGGTAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561336_993561343 14 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561336_993561344 15 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561336_993561342 -3 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561336 Original CRISPR AGCCAAAGGTTGGGTAGATT GGG (reversed) Intergenic
No off target data available for this crispr