ID: 993561339

View in Genome Browser
Species Human (GRCh38)
Location 5:89414518-89414540
Sequence AATCATTAGTAGCCAAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561339_993561343 4 Left 993561339 5:89414518-89414540 CCAACCTTTGGCTACTAATGATT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561339_993561344 5 Left 993561339 5:89414518-89414540 CCAACCTTTGGCTACTAATGATT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561339 Original CRISPR AATCATTAGTAGCCAAAGGT TGG (reversed) Intergenic
No off target data available for this crispr