ID: 993561342

View in Genome Browser
Species Human (GRCh38)
Location 5:89414528-89414550
Sequence GCTACTAATGATTGGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561337_993561342 -4 Left 993561337 5:89414509-89414531 CCAATCTACCCAACCTTTGGCTA No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561336_993561342 -3 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561333_993561342 -1 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561335_993561342 -2 Left 993561335 5:89414507-89414529 CCCCAATCTACCCAACCTTTGGC No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561332_993561342 26 Left 993561332 5:89414479-89414501 CCTTATGTTAGTGTTATATGATT No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561342 Original CRISPR GCTACTAATGATTGGTTGTG TGG Intergenic
No off target data available for this crispr