ID: 993561343

View in Genome Browser
Species Human (GRCh38)
Location 5:89414545-89414567
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561335_993561343 15 Left 993561335 5:89414507-89414529 CCCCAATCTACCCAACCTTTGGC No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561337_993561343 13 Left 993561337 5:89414509-89414531 CCAATCTACCCAACCTTTGGCTA No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561339_993561343 4 Left 993561339 5:89414518-89414540 CCAACCTTTGGCTACTAATGATT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561336_993561343 14 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561333_993561343 16 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561341_993561343 0 Left 993561341 5:89414522-89414544 CCTTTGGCTACTAATGATTGGTT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561338_993561343 5 Left 993561338 5:89414517-89414539 CCCAACCTTTGGCTACTAATGAT No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type