ID: 993561344

View in Genome Browser
Species Human (GRCh38)
Location 5:89414546-89414568
Sequence TGTGGTAGACCCTTAACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561339_993561344 5 Left 993561339 5:89414518-89414540 CCAACCTTTGGCTACTAATGATT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561337_993561344 14 Left 993561337 5:89414509-89414531 CCAATCTACCCAACCTTTGGCTA No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561341_993561344 1 Left 993561341 5:89414522-89414544 CCTTTGGCTACTAATGATTGGTT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561333_993561344 17 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561338_993561344 6 Left 993561338 5:89414517-89414539 CCCAACCTTTGGCTACTAATGAT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561336_993561344 15 Left 993561336 5:89414508-89414530 CCCAATCTACCCAACCTTTGGCT No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data
993561335_993561344 16 Left 993561335 5:89414507-89414529 CCCCAATCTACCCAACCTTTGGC No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561344 Original CRISPR TGTGGTAGACCCTTAACTTT GGG Intergenic
No off target data available for this crispr