ID: 993562979

View in Genome Browser
Species Human (GRCh38)
Location 5:89434873-89434895
Sequence GAGTTCCCTGGCATTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993562976_993562979 -7 Left 993562976 5:89434857-89434879 CCCTGAGAAGTATGTTGAGTTCC No data
Right 993562979 5:89434873-89434895 GAGTTCCCTGGCATTCTTAAAGG No data
993562977_993562979 -8 Left 993562977 5:89434858-89434880 CCTGAGAAGTATGTTGAGTTCCC No data
Right 993562979 5:89434873-89434895 GAGTTCCCTGGCATTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993562979 Original CRISPR GAGTTCCCTGGCATTCTTAA AGG Intergenic
No off target data available for this crispr