ID: 993564555

View in Genome Browser
Species Human (GRCh38)
Location 5:89457347-89457369
Sequence TGTTGGCTAGAACACTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993564549_993564555 21 Left 993564549 5:89457303-89457325 CCTAACTGATTTTATTAATGAGA No data
Right 993564555 5:89457347-89457369 TGTTGGCTAGAACACTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993564555 Original CRISPR TGTTGGCTAGAACACTGAGC TGG Intergenic
No off target data available for this crispr