ID: 993564663

View in Genome Browser
Species Human (GRCh38)
Location 5:89458310-89458332
Sequence ATATAAAAGCAGACTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993564663_993564671 27 Left 993564663 5:89458310-89458332 CCTTGCCCAGTCTGCTTTTATAT No data
Right 993564671 5:89458360-89458382 ATTGTTCCATGTTAACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993564663 Original CRISPR ATATAAAAGCAGACTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr