ID: 993566929

View in Genome Browser
Species Human (GRCh38)
Location 5:89488085-89488107
Sequence TCTAATAAGCAGCTTTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993566926_993566929 3 Left 993566926 5:89488059-89488081 CCAGGACATTCTTGCCAGTGCTA No data
Right 993566929 5:89488085-89488107 TCTAATAAGCAGCTTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993566929 Original CRISPR TCTAATAAGCAGCTTTTGCT GGG Intergenic
No off target data available for this crispr