ID: 993567164

View in Genome Browser
Species Human (GRCh38)
Location 5:89490051-89490073
Sequence CCTTGGCTCTTTCTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993567164_993567173 29 Left 993567164 5:89490051-89490073 CCAGAAGCTAGAAAGAGCCAAGG No data
Right 993567173 5:89490103-89490125 CCTGACCCTGCTTCCCAATTTGG No data
993567164_993567168 3 Left 993567164 5:89490051-89490073 CCAGAAGCTAGAAAGAGCCAAGG No data
Right 993567168 5:89490077-89490099 GAATTCCCTGTAAGTTTCAGAGG No data
993567164_993567174 30 Left 993567164 5:89490051-89490073 CCAGAAGCTAGAAAGAGCCAAGG No data
Right 993567174 5:89490104-89490126 CTGACCCTGCTTCCCAATTTGGG No data
993567164_993567169 4 Left 993567164 5:89490051-89490073 CCAGAAGCTAGAAAGAGCCAAGG No data
Right 993567169 5:89490078-89490100 AATTCCCTGTAAGTTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993567164 Original CRISPR CCTTGGCTCTTTCTAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr