ID: 993567981

View in Genome Browser
Species Human (GRCh38)
Location 5:89498977-89498999
Sequence CTGCTGTCGTTATTAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993567974_993567981 27 Left 993567974 5:89498927-89498949 CCACAGGACTTTCTTGGCTTGCG No data
Right 993567981 5:89498977-89498999 CTGCTGTCGTTATTAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993567981 Original CRISPR CTGCTGTCGTTATTAAACAC AGG Intergenic
No off target data available for this crispr