ID: 993579796

View in Genome Browser
Species Human (GRCh38)
Location 5:89646155-89646177
Sequence CAAAATAAAGTGAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993579796_993579802 -4 Left 993579796 5:89646155-89646177 CCCCCCTCCTTCACTTTATTTTG No data
Right 993579802 5:89646174-89646196 TTTGCATAGCATTACATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993579796 Original CRISPR CAAAATAAAGTGAAGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr