ID: 993590947 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:89794630-89794652 |
| Sequence | CGGCCAACAGCAGTGGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993590947_993590954 | 23 | Left | 993590947 | 5:89794630-89794652 | CCATCCACCACTGCTGTTGGCCG | No data | ||
| Right | 993590954 | 5:89794676-89794698 | TCCATCCCTCCAGATCCAAAAGG | No data | ||||
| 993590947_993590956 | 24 | Left | 993590947 | 5:89794630-89794652 | CCATCCACCACTGCTGTTGGCCG | No data | ||
| Right | 993590956 | 5:89794677-89794699 | CCATCCCTCCAGATCCAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993590947 | Original CRISPR | CGGCCAACAGCAGTGGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||