ID: 993590949

View in Genome Browser
Species Human (GRCh38)
Location 5:89794637-89794659
Sequence GCAACAGCGGCCAACAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993590949_993590954 16 Left 993590949 5:89794637-89794659 CCACTGCTGTTGGCCGCTGTTGC No data
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data
993590949_993590956 17 Left 993590949 5:89794637-89794659 CCACTGCTGTTGGCCGCTGTTGC No data
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993590949 Original CRISPR GCAACAGCGGCCAACAGCAG TGG (reversed) Intergenic
No off target data available for this crispr