ID: 993590950

View in Genome Browser
Species Human (GRCh38)
Location 5:89794650-89794672
Sequence CAGTGGCGGGTCTGCAACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 3, 1: 6, 2: 34, 3: 74, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993590950_993590956 4 Left 993590950 5:89794650-89794672 CCGCTGTTGCAGACCCGCCACTG 0: 3
1: 6
2: 34
3: 74
4: 195
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590950_993590954 3 Left 993590950 5:89794650-89794672 CCGCTGTTGCAGACCCGCCACTG 0: 3
1: 6
2: 34
3: 74
4: 195
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993590950 Original CRISPR CAGTGGCGGGTCTGCAACAG CGG (reversed) Intergenic
900350794 1:2233570-2233592 CAGTGGAGGGTCCGCGACGGGGG + Intronic
900620051 1:3582600-3582622 CAGTGAAGGGTTTGCAACCGGGG - Intronic
901870802 1:12138292-12138314 CTGTGGCAGGTCTCCATCAGTGG - Exonic
903489914 1:23720535-23720557 CAGTGGAGGGTCTGTATGAGAGG - Intergenic
903804508 1:25995321-25995343 CAGTGACTTGCCTGCAACAGTGG + Intronic
907504959 1:54911352-54911374 CAGTGGCGGGTCTGTGACGGTGG + Intergenic
907506072 1:54919125-54919147 CAGTGGAGGGTCTGTGACAGCGG + Intergenic
907756149 1:57312784-57312806 CAGTGGCCGGTGAGCAGCAGTGG + Intronic
908723225 1:67148208-67148230 CAGTGGTGGGTCTGCGACAACGG + Intronic
908852963 1:68392374-68392396 CAGCCGCGGGTCTGCGACAGCGG + Intergenic
909800118 1:79796610-79796632 CAGGGGCGGGCCTGCCACTGAGG + Intergenic
910116682 1:83739190-83739212 CAGTGACGGGTCTGGGACGGTGG + Intergenic
911485504 1:98500268-98500290 CAGTGGCTGGTCTGGAACCTGGG + Intergenic
912211305 1:107560106-107560128 CAGTGGCGAGTCTGAAGCAGTGG - Intergenic
916240160 1:162631680-162631702 AAGGGGCGGGTAGGCAACAGGGG - Intronic
919082777 1:192886777-192886799 CAGCGGCAGGTCTGCGACAGTGG + Intergenic
920639852 1:207741498-207741520 CAGCGGTGGGTCTGCGACGGCGG + Intergenic
922007936 1:221551035-221551057 CAGTGGCGGGTCTGTGACAGCGG + Intergenic
922876308 1:228942532-228942554 CAGCGGCAGGTCTGCCACTGCGG - Intergenic
923173648 1:231442124-231442146 CATTGGAGGGTTTTCAACAGAGG + Intergenic
924439985 1:244077969-244077991 CAGTGGCGGTGCAGAAACAGGGG - Intergenic
1064901069 10:20296719-20296741 CAGTGGTGGGTGTAGAACAGCGG + Intergenic
1065222796 10:23513357-23513379 CAGTGACGGGTCTGCGACAGAGG + Intergenic
1066246836 10:33591944-33591966 CAGTGGCAGGTCTGCGATGGCGG + Intergenic
1068191614 10:53659772-53659794 CAGTGGCGGGTCTGCGACGTCGG - Intergenic
1068791295 10:61034032-61034054 CAGTGGCAGGTCTGCAATGGCGG + Intergenic
1068792071 10:61039497-61039519 CAGTGGCGGGTCTGCGATGGCGG + Intergenic
1071051874 10:81460181-81460203 CAGTGGCGGGTCTGCTACGGAGG - Intergenic
1071327415 10:84530654-84530676 CAGCGGCGGGTCTGCAATGGTGG + Intergenic
1071331539 10:84565550-84565572 CAGCGGCGGGTCTGCGACGGCGG + Intergenic
1072472436 10:95724709-95724731 CAGTGATGGGTCTGCGACGGTGG + Intronic
1072650308 10:97290239-97290261 CAGCGGCGGGTCTGCGACAGCGG - Intronic
1074339515 10:112613562-112613584 CAGTGAAGAGTCTGCAAAAGAGG - Intronic
1074978464 10:118599869-118599891 CAGAGGCGGGTCTGCGACGACGG + Intergenic
1075667896 10:124244027-124244049 GACTGGCGGGGCTGAAACAGTGG + Intergenic
1076424297 10:130356614-130356636 CAGCGGCGGGTCTGCTACGCCGG - Intergenic
1077352178 11:2098111-2098133 CAGGTGCTGGTCTGCAACATGGG + Intergenic
1078191861 11:9097708-9097730 CAGCGGCGGGTCTGCGACGGTGG - Intronic
1079678727 11:23265129-23265151 CAGCAGCGGGTCTGCAACGGTGG + Intergenic
1079761852 11:24338947-24338969 CAGCGGCAGGTCTGCAATGGCGG - Intergenic
1079884283 11:25966541-25966563 CAGTGGCAGGTCTGCTACGACGG + Intergenic
1079934240 11:26597514-26597536 CAGCGGTGGGTCTGTGACAGTGG + Intronic
1081751242 11:45512789-45512811 CATTGGGGGGTTTGAAACAGTGG - Intergenic
1083296376 11:61717707-61717729 CAGTGACAGGCCTGCACCAGTGG - Intronic
1084878725 11:72154320-72154342 CAGCGGCGGGTCTGCGATGGCGG - Intergenic
1087901301 11:103644872-103644894 CAATGGCGGGTCTGCGACGGCGG + Intergenic
1088484622 11:110328726-110328748 CAGTGGCAGGTCTGTGACAGCGG + Intergenic
1088879802 11:113964506-113964528 CAGCGGCAGGTCTGCAACGGCGG - Intergenic
1091335203 11:134761441-134761463 CAGAGGCAGGTCTGCAAGAGGGG - Intergenic
1092293644 12:7181286-7181308 CAGCAGCAGGTCTACAACAGTGG - Intergenic
1093106663 12:15095441-15095463 CAGTGGCGGGTCTGCGACGGTGG + Intergenic
1094312873 12:29104830-29104852 CAGTGTGAGGTCTGCAAAAGGGG - Intergenic
1094640995 12:32275662-32275684 CAGCGGCGGGTCTGCGACAGTGG - Intronic
1095138576 12:38636640-38636662 GAATGGCAGGTCTGCAACAGCGG - Intergenic
1095284198 12:40389188-40389210 CAACAGTGGGTCTGCAACAGTGG - Intergenic
1095893111 12:47253042-47253064 CAGCGGCAGGTCTGCGACGGTGG + Intergenic
1096351235 12:50902841-50902863 CAGTGGCGGGTCTGCAACAGCGG + Intergenic
1097840845 12:64319978-64320000 CAGTGGCGGGTCTGCCAAGGCGG - Intronic
1099292616 12:80790093-80790115 CAGTGGCGGGTCTGTGACAGCGG - Intergenic
1099798631 12:87429628-87429650 CAGTGGCAGGTCTGCGATGGCGG + Intergenic
1103399962 12:120637146-120637168 CACTGGTGGGTTTGCAGCAGTGG - Intergenic
1103802555 12:123548813-123548835 CAGTGACGGGTCTGCGACGGTGG - Intergenic
1103803996 12:123558398-123558420 CAGCGGCGGGTCTGCAACGGCGG - Intergenic
1103872342 12:124100822-124100844 TAGTGGCGGGTCTGCGACGGCGG + Intronic
1104187866 12:126449654-126449676 CAGCGGCGGGTCTGCAACAGCGG + Intergenic
1106321609 13:28644591-28644613 CAGTGAGGAGGCTGCAACAGAGG - Intergenic
1107877476 13:44803576-44803598 CTCTGGCTGGTCTGCATCAGTGG - Intergenic
1108876195 13:55054023-55054045 CAGGGGCGGGTCTACGACAGTGG - Intergenic
1108877215 13:55061338-55061360 CAGGGGCGGGTCTGCGACAGTGG - Intergenic
1109520631 13:63505566-63505588 CAGAGGCGGGTCTGTGACAGCGG + Intergenic
1109523586 13:63545126-63545148 CAGCGGAGGGTCTGCGACAGCGG + Intergenic
1111021442 13:82457701-82457723 CAGTGGTAGGTCTGCGACGGAGG - Intergenic
1111408466 13:87842423-87842445 CACTGGCAGTTCTGCAAAAGTGG + Intergenic
1114840840 14:26260601-26260623 CAGTGGCGGGTCTGTGATGGCGG - Intergenic
1119089943 14:71772197-71772219 CAGAGGCGGGTCTGCGGCGGCGG + Intergenic
1122270302 14:100566000-100566022 CAGTGTCGGGGCTGCCCCAGTGG - Intronic
1123015124 14:105369784-105369806 CAGCGGCGGGTCTGCAGCTCTGG + Intronic
1123116617 14:105897718-105897740 CTTTGGCGGGTGTGCAAGAGGGG - Intergenic
1123120898 14:105916585-105916607 CTTTGGCGGGTGTGCAAGAGGGG - Intergenic
1123915789 15:25025342-25025364 CAGTGGCAGGGTTGCAGCAGAGG + Intergenic
1127074517 15:55312217-55312239 CAGCGGCGGGTCTGCGACAGCGG + Intronic
1127907005 15:63383208-63383230 CAGTGCAGGGTCTGCAAAATAGG + Intergenic
1128363110 15:66976464-66976486 CAGTGGTGGGTCTGCAACAGTGG + Intergenic
1128650721 15:69410819-69410841 CTGTGGTGGGTCTCCAACAATGG + Intergenic
1129776376 15:78239309-78239331 CAGCAGCGGGTCTGCGACAGCGG + Intronic
1131673847 15:94651158-94651180 CAGTGGCGGGTCTGCGATGGCGG - Intergenic
1132138015 15:99363244-99363266 CAATGGCAGGGCTGCACCAGTGG + Exonic
1133117074 16:3583373-3583395 CAGTGAGGCGCCTGCAACAGCGG + Exonic
1134302730 16:13005919-13005941 CAGGGGAAGGTCTGAAACAGTGG + Intronic
1138101268 16:54253980-54254002 CAGTGGTGGGTCTGGCACGGTGG + Intronic
1141488010 16:84353968-84353990 CAGTGGCGGGACTCCCACATGGG + Intergenic
1142185190 16:88691572-88691594 CAGGGGCGGGCCTGGGACAGGGG + Intergenic
1142212665 16:88815932-88815954 CAGTGGCGTCTCTGGCACAGAGG - Intronic
1142278317 16:89134479-89134501 CAGCGGCGGGTCTGCAACGGCGG + Intronic
1145162173 17:20583084-20583106 CAGTGGTGGGTGAGCAGCAGAGG - Intergenic
1146673811 17:34759425-34759447 GGGTGGCGGGTGTGCAGCAGGGG + Intergenic
1146887813 17:36484093-36484115 CAGTGGTGAGTCCGCCACAGTGG + Intergenic
1148234297 17:45957515-45957537 CAGTGCTGGGGCTGCCACAGTGG - Intronic
1148371993 17:47106741-47106763 CAGTGGCGGGTCTGCGATGGCGG + Intergenic
1149243109 17:54673755-54673777 CAGTGGCGGGTCTGTGACGGCGG + Intergenic
1153154025 18:2128777-2128799 CAGTGGGGTGGCTGCAGCAGGGG - Intergenic
1153904806 18:9651757-9651779 CAGAGGCAGGACTGCATCAGAGG - Intergenic
1154470215 18:14693355-14693377 CAGTGGTGGTACTGCTACAGTGG + Intergenic
1155560468 18:27070937-27070959 TACTGGGGGGTCAGCAACAGAGG - Intronic
1157259335 18:46165123-46165145 CAGCGGCGGGTCTGCAGCAGCGG - Intergenic
1158152296 18:54386987-54387009 CAGCGGCGGGTCTGCGACGGCGG - Intergenic
1160031708 18:75267475-75267497 CAGTGGTGGGGCTGCGCCAGTGG + Intronic
1160051464 18:75438030-75438052 CAGCGGAGGTTCTGCAGCAGAGG + Intergenic
1160479469 18:79225694-79225716 CAGTGGCCGCCCTGCAACTGCGG - Intronic
1160479501 18:79225898-79225920 CAGTGGCCGCCCTGCAACTGCGG - Intronic
1160757054 19:763363-763385 GAGTAGAGGGTCTGAAACAGAGG + Intronic
1164056874 19:21629493-21629515 CAGTGGCAGGTCTGCAATGGCGG - Intergenic
1164967311 19:32496681-32496703 CAGGAGCGGGTCTGCAAGAATGG - Intergenic
1165079474 19:33299284-33299306 CTGAGGCAGGCCTGCAACAGGGG - Intergenic
1165367598 19:35378290-35378312 GACTGGGGGATCTGCAACAGGGG - Intergenic
1166117220 19:40663348-40663370 GAGGGGCGGGGCTGCAACGGAGG + Intergenic
1168147016 19:54425228-54425250 CAGCGGCGGGTCTGCGACGGCGG + Intronic
927820324 2:26258560-26258582 CAACAGCGGGTCTGCGACAGTGG + Intronic
928319122 2:30269280-30269302 CAGCGGCGGGTCTGCAACGGCGG - Intronic
928440102 2:31285110-31285132 TAGCGGCGGGTCTGCGACAGCGG - Intergenic
929542357 2:42832114-42832136 CAGCGGCGGGTCTGCCATGGCGG - Intergenic
931038983 2:58275770-58275792 CAGCAGCAGGTCTGCGACAGCGG - Intergenic
932917175 2:75872073-75872095 CAGTGGCGGGTCCGGCACAACGG - Intergenic
933175735 2:79170198-79170220 CAGTGGCGGGTCTGCGACGGTGG + Intergenic
933328829 2:80871707-80871729 CAGCAGCGGGTCTGCAACGGTGG - Intergenic
934672431 2:96223163-96223185 CAGCAGCAGGTCTGCAACGGTGG + Intergenic
935443019 2:103123760-103123782 CAGACGGTGGTCTGCAACAGTGG + Intergenic
936593084 2:113822070-113822092 CAGTGGCAAGTCAGCAAGAGGGG - Intergenic
936868891 2:117109675-117109697 CAGTGGCGGATCTGTGACAGCGG - Intergenic
938812633 2:134867681-134867703 CTGTGTGGGGTCTGGAACAGAGG + Intronic
939134085 2:138273500-138273522 CAGCGGTGGGTCTGCGACATCGG + Intergenic
939492982 2:142899073-142899095 CAATGGCAGGTCTGTAACAGCGG + Intronic
939493159 2:142900268-142900290 CAGTGGTGGGTCTGCAACGGTGG + Intronic
939494107 2:142907481-142907503 CAATGGCGGGTCTGCAATGGTGG + Intronic
940669040 2:156645160-156645182 CAGTGGTGGGTCTGCGATGGTGG - Intergenic
941395562 2:164968891-164968913 CAGCGGCAGGTCTGCGATAGTGG + Intergenic
942580693 2:177412997-177413019 CAGCGGCGGGTCTGCGATGGCGG + Intronic
942699690 2:178691515-178691537 TAGTGGCGAGTCTTCAATAGTGG - Intronic
942830308 2:180232074-180232096 CAATGGCAGGTCTGCAACAGTGG - Intergenic
943082869 2:183277594-183277616 CAGTGCTGGGTCAGTAACAGTGG + Intergenic
944039793 2:195339921-195339943 CAATGGCGGGTATGCGACGGCGG + Intergenic
946681039 2:222216166-222216188 TAGTGGCTGGTCAGCACCAGAGG - Intronic
948826766 2:240576795-240576817 CAGGGGCTGGGGTGCAACAGCGG + Intronic
1169274191 20:4221911-4221933 CACTGGCGGGCCTCCACCAGCGG - Exonic
1169709299 20:8543436-8543458 CAGTGGCGGCCTGGCAACAGGGG + Intronic
1169732423 20:8801040-8801062 CATTGAAGGGTCTTCAACAGAGG - Intronic
1172634457 20:36400782-36400804 CAGTGACGTGCCTGGAACAGGGG + Intronic
1172947194 20:38698764-38698786 CAGCGGCGGGTCTGCGAGGGCGG - Intergenic
1173957019 20:47041123-47041145 CAGGGGCGGGACTGCTTCAGCGG - Intronic
1173994377 20:47326500-47326522 CAGTGGCGGGTCTCCTAGAAGGG - Intronic
1175346625 20:58283344-58283366 CAGAGGCTGGACTGTAACAGAGG + Intergenic
1176804280 21:13464510-13464532 CAGTGGTGGTACTGCTACAGTGG - Intergenic
1177263010 21:18753106-18753128 CAGTGGCAGGTCTGCGACAGCGG + Intergenic
1177531193 21:22360130-22360152 CAGCGGTGGGTCTGTGACAGCGG + Intergenic
1177531196 21:22360147-22360169 CAGCGGCGGGTCTGTGACAGCGG + Intergenic
1177738125 21:25118795-25118817 CAGCGGCGGGTCTGCTACCACGG - Intergenic
1177896705 21:26861664-26861686 CAGCGACGGGTCTGCAACGGCGG - Intergenic
1179259610 21:39746257-39746279 CAGCGGCGGGTCTGCGATGGTGG + Exonic
1183228536 22:36566323-36566345 CAGTGGCAGGACTGGATCAGTGG + Intronic
1185008372 22:48299237-48299259 CAGTGGCGGAGCTGCAACCCTGG + Intergenic
950572095 3:13807635-13807657 CAGTGGAGGGCCTGAACCAGGGG - Intergenic
951201176 3:19876472-19876494 CAGCGGCGGGTCTGCGACAGTGG + Intergenic
951326074 3:21303115-21303137 CAGCGGCGGGTCCGCGACGGCGG + Intergenic
951837645 3:27001155-27001177 CAGCGGCGGGTCTGTGACTGCGG - Intergenic
953129215 3:40121643-40121665 CAGTGCTGGGTTTGCACCAGTGG - Intronic
953505896 3:43485280-43485302 CAGCAGCGGGTCTGCGACGGTGG - Intronic
953515824 3:43591207-43591229 CAATGGTGGGTCTGCAACTGCGG - Intronic
955381276 3:58440204-58440226 CAGCAGCGGGTCTGCAACGGTGG + Intergenic
957687042 3:83515307-83515329 CAGCGGCAGGTCTGCGACAGGGG - Intergenic
957895108 3:86411976-86411998 CAGCAGCGGATCTGCAACAGTGG - Intergenic
958424503 3:93965290-93965312 CAGCAGCGGGTCTGCGACGGCGG - Intronic
958630368 3:96675032-96675054 CAGCAGCGGGTCTGCAATGGTGG + Intergenic
959161773 3:102732800-102732822 CAGTGGCGGGTCTGTGACAGCGG + Intergenic
959450014 3:106487186-106487208 CAGCGGCGGGTCTGCGACAGTGG + Intergenic
961524186 3:127486111-127486133 CAGTGGCGGAGCTGCAGGAGGGG + Intergenic
963024089 3:140901164-140901186 CAGCGGTGGGTCTGCGACAGTGG - Intergenic
963255682 3:143142504-143142526 CAGCGGCAGGTCTGCAACTGCGG - Intergenic
967623099 3:191658928-191658950 CAGTGGTGGGTCTGCCATGGTGG - Intergenic
968390874 4:192126-192148 CAGTGGTGGGTCTGCGATGGTGG + Intergenic
968983080 4:3861206-3861228 CAGTGTTGGGTCTTCAACGGAGG - Intergenic
969162619 4:5274814-5274836 CAGCGGCGGGTCTGCAACCGCGG - Intronic
971980351 4:33742964-33742986 CAGTGGTGGGTCTGCGACAGTGG - Intergenic
972766772 4:42158551-42158573 CAGTGGCAGGTCTGCGACGGCGG + Intergenic
972780837 4:42285732-42285754 CAGTGGTGGGTCTGCGATGGCGG + Intergenic
972853839 4:43082237-43082259 CAGCGGCGGCTCTGCAATGGGGG - Intergenic
973205071 4:47550831-47550853 CAGCGGCGGGTCTGCGATGGTGG + Intronic
974190094 4:58493404-58493426 CAGCGGCGGGTCTGCGATGGTGG + Intergenic
974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG + Intergenic
978587028 4:110284283-110284305 CAGCGGTGGGTCTGCAAAGGTGG + Intergenic
979401773 4:120257593-120257615 CAGTGATGGATCTGCAAAAGTGG + Intergenic
979910830 4:126363691-126363713 CAGTGGTAGGTCTGCAATGGTGG - Intergenic
980625714 4:135372317-135372339 CAGGGGCGGGTCTGCGACGGCGG - Intergenic
980871970 4:138622119-138622141 CAGTGGCAGGTCTGCGATGGTGG + Intergenic
981823743 4:148915609-148915631 CAGTGGCGGGTTTGCAAGGATGG - Intergenic
982332113 4:154192488-154192510 CAATGGCGGGTCTGCCACGATGG - Intergenic
983667441 4:170196948-170196970 CAGTGGTGGGTCTGCAACAGCGG + Intergenic
983777795 4:171629899-171629921 CAGCGGCGGGTCTGTGACAGCGG - Intergenic
986918841 5:12660745-12660767 CAGCAGCGGGTCTGCGACGGCGG + Intergenic
987129611 5:14848539-14848561 CAGCGGCGGGTCTGCGATGGCGG - Intronic
988363426 5:30265492-30265514 CAGTGGAGAATCTCCAACAGAGG + Intergenic
988957397 5:36332961-36332983 CAGCGGCGGGTCTGCGATGGCGG + Intergenic
990741374 5:58915939-58915961 CAGCGGCGGGTCTGCGACTGCGG - Intergenic
990891810 5:60658890-60658912 CAGTGGCCGGTCTGCGACAGTGG - Intronic
990892807 5:60666096-60666118 CAGTGGCGAGTCTGCGACAGTGG - Intronic
990905181 5:60795634-60795656 CAGTGGCGAGTCTCCGACATCGG - Intronic
990997177 5:61744700-61744722 CATTGGAGGGACTACAACAGAGG - Intronic
993054987 5:82970969-82970991 CAGCAGCGGGTCTGCAACACTGG + Intergenic
993225636 5:85165309-85165331 CAGCAGCGGGTCTGCGACAGTGG - Intergenic
993460760 5:88177711-88177733 CAGGGGCGGGTCTGCGACAGCGG + Intergenic
993590950 5:89794650-89794672 CAGTGGCGGGTCTGCAACAGCGG - Intergenic
993941856 5:94068373-94068395 CAGTGGCAGGTCTGCGAAGGTGG + Intronic
995465166 5:112444090-112444112 CAGCGGCGGGTCTGCGACGGTGG - Intergenic
995466153 5:112451112-112451134 CAGCGGTGGGTCTGCGACAGTGG - Intergenic
995785081 5:115819071-115819093 CGGTGGCGGGTCTGTGACAGTGG + Intergenic
998644314 5:144045553-144045575 CAGTGGCGGGTCTGGGACTGCGG - Intergenic
1000487361 5:161863975-161863997 CAGTGGCGGGGCAGCAAGGGGGG - Intronic
1002622021 5:180494646-180494668 CGGTGGCGGCGCTGCAGCAGCGG + Exonic
1003984390 6:11420213-11420235 CAGTGCCAGGTCAGCCACAGGGG + Intergenic
1004007311 6:11649056-11649078 CAGAGGCGGGTCTGTGACGGCGG - Intergenic
1004022665 6:11789052-11789074 CAGTGGCGGGTCAGCGGCAGGGG - Intronic
1004256411 6:14068827-14068849 CAGCGGCGGGTCTGCGGCAGTGG - Intergenic
1005324145 6:24682685-24682707 CGGTGGCGGGTCTGCGATGGCGG + Intronic
1005816656 6:29558605-29558627 CAGCCGCGGGTCTGCGACGGTGG - Intronic
1007011952 6:38426542-38426564 CAGCGGTGGGTCTGCGACGGCGG - Intronic
1008582774 6:52921498-52921520 CAGTGGCGGGTCTGTGACAGCGG + Intergenic
1009199505 6:60726522-60726544 CACCGGCGGGTGTGCGACAGCGG - Intergenic
1009544324 6:65005129-65005151 CAGCAGCTGGTCTGCAACAGTGG - Intronic
1009702459 6:67201733-67201755 CAGCGGTGGGTCTGCGACGGCGG - Intergenic
1010974276 6:82295170-82295192 CAGTGTAGGGTCTGGCACAGTGG - Intergenic
1011131643 6:84058123-84058145 CACTGGAGGGTCTGGAGCAGAGG + Intronic
1011189088 6:84712048-84712070 CAATGGCGGGTCTGCAACGGCGG + Intronic
1011540392 6:88421340-88421362 CAGCGGCGGGTCTGCGAAGGCGG + Intergenic
1012120017 6:95354749-95354771 CAGTGGCAGGTCTGCGACAGTGG - Intergenic
1012734539 6:102921683-102921705 CAGTAGTGGGTCTGCGACTGTGG + Intergenic
1013410507 6:109879619-109879641 CAGTGGCAGGTCTGCGACGGTGG - Intergenic
1014208913 6:118687772-118687794 CAGTCGTGGGTCTGCAACGGCGG - Intronic
1016343651 6:143087548-143087570 CAGCGGCGGGTCTGCGACGGCGG + Intronic
1016444925 6:144121404-144121426 CAGCGGTGGGTCTGCGACAGTGG + Intergenic
1017869006 6:158470226-158470248 CAGCGGCGGGTCTGCGACGGCGG + Intronic
1017950119 6:159129139-159129161 CAGTGGCGGGTGTGCTCCTGCGG + Intergenic
1021885341 7:25131933-25131955 CAGCGGCGGGTCTGCGACGGCGG + Intergenic
1022117655 7:27276485-27276507 CAGTGGCAGGTCTGCGACGGCGG - Intergenic
1023733136 7:43210824-43210846 CAGTAGTGGGTCTGCAATGGCGG + Intronic
1024318652 7:48044212-48044234 TAGCGGCGGGTCTGCAACGGAGG + Intronic
1025716581 7:63962637-63962659 CAGCGGCAGGTCTGCGACAGTGG + Intergenic
1027600302 7:80232010-80232032 CAAGGGCGTGTCTGCAAGAGGGG + Intergenic
1027677961 7:81182322-81182344 CAGCAGCAGGTCTGCGACAGCGG + Intronic
1027778113 7:82491983-82492005 CTCTGGCGGATCTGCAGCAGAGG - Intergenic
1028593214 7:92520707-92520729 TACTGGCAGGGCTGCAACAGAGG + Intronic
1029015970 7:97315951-97315973 CAGTGGCGGGTCTGCAATAGAGG - Intergenic
1030336807 7:108337424-108337446 CAGCAGTGGGTCTGCAACGGTGG - Intronic
1030661146 7:112221042-112221064 CAGCGGCGGGTCTGCGATGGTGG - Intronic
1030843982 7:114386141-114386163 CGGCGGTGGGTCTGCGACAGTGG + Intronic
1031250876 7:119378936-119378958 CAGCAGCGGGTCTGCGGCAGCGG + Intergenic
1031299573 7:120047484-120047506 CAGTGGCGGGTCTCCGATGGCGG - Intergenic
1031471998 7:122177209-122177231 CAGTGGCGGGTCTACGATGGCGG - Intergenic
1032725341 7:134585817-134585839 CAATGGAGGGTCTGCGACAGTGG - Intergenic
1032726293 7:134592650-134592672 CAATGGAGGGTCTGCGACAGTGG - Intergenic
1034248767 7:149671715-149671737 CAGTGGCAGGTCTGCGATGGCGG - Intergenic
1034650845 7:152688847-152688869 CAGTGGCGGGTCTGCGACGGCGG + Intergenic
1034965012 7:155385392-155385414 CGGCGGCGGGTCTGCGACGGCGG + Intronic
1035326358 7:158068392-158068414 CAGTGGCTGGACTGCAGCTGGGG + Intronic
1035584179 8:759324-759346 GAGTGGTGTGTCTGCCACAGTGG + Intergenic
1036557403 8:9872410-9872432 CAGTGGCTGCTCTGCTACCGTGG + Intergenic
1039316271 8:36376052-36376074 CAGAGGAAGGTCTGCCACAGTGG + Intergenic
1039604317 8:38868064-38868086 CAGCGATGGGTCTGCCACAGCGG + Intergenic
1041261005 8:56020499-56020521 CTGTGGCTGGGCTGCAAAAGGGG - Intergenic
1041741914 8:61165224-61165246 CAGCGGCGGGTCTGCGACAGTGG + Intronic
1042039850 8:64579683-64579705 CAGTGGCGGGTGTGGAAACGAGG + Intergenic
1042055655 8:64763095-64763117 CAGTGGCGGGTCTGCAACAGTGG - Intronic
1042292927 8:67188673-67188695 CAGTGGCAGGTCTGCAACGGCGG - Intronic
1043543219 8:81286614-81286636 CAGTGGAGGGTTCTCAACAGAGG - Intergenic
1044114534 8:88318673-88318695 CAGTGTTGGATCTGCAACACAGG - Intronic
1044206181 8:89494212-89494234 CACTGGCAGGCCAGCAACAGTGG + Intergenic
1044245444 8:89939169-89939191 GACTGGTGGGTCTGCAGCAGAGG + Intronic
1044542612 8:93424664-93424686 CGGGGGCGGGGCTGCATCAGTGG - Intergenic
1044988292 8:97774183-97774205 CAACGGCGGGTCTGCAACAGCGG + Intergenic
1045863516 8:106839376-106839398 CAATGGCAGGTCTGCAATGGCGG + Intergenic
1047599746 8:126413952-126413974 CAGTGGTGGGTCTGCGATGGTGG + Intergenic
1048100257 8:131343212-131343234 CAGTGGCAGGTCTGTGACAATGG + Intergenic
1049340082 8:142107447-142107469 GAATGGCAGGTCTGGAACAGAGG - Intergenic
1053134336 9:35640665-35640687 CAGCGGCAGGTCTGCGACAGTGG + Intronic
1053215192 9:36265029-36265051 CAGCGGCGGGTCTGCGACTGCGG - Intronic
1054749148 9:68886791-68886813 CATTGGAGGGTCTGGAGCAGAGG - Intronic
1055431341 9:76247204-76247226 CAGCGGCAGGTCTGTGACAGCGG + Intronic
1055455697 9:76469625-76469647 CAGTGGCAGGTCTGCAACAGCGG - Intronic
1057029895 9:91767646-91767668 CCGTTGCGGGTGTGGAACAGTGG + Intronic
1057176978 9:93007661-93007683 CAGTGGCTAGCCTGCAACCGGGG - Intronic
1058189015 9:101890476-101890498 AAGTGAAGGGTCTGCAACAATGG + Intergenic
1058813017 9:108659567-108659589 GAGGGGAGGGTCTGCAACAAAGG - Intergenic
1061263528 9:129492796-129492818 CAGTGGAGGGTTGGCCACAGTGG - Intergenic
1061856727 9:133445580-133445602 AAGTGGCGTGTGTGCACCAGGGG - Intronic
1061873915 9:133534685-133534707 CAGTGGCGGCTCTGCGCCGGCGG - Intronic
1185560911 X:1060092-1060114 CAAAGGTGGGTCTGCAACGGCGG - Intergenic
1189152097 X:38719493-38719515 CAATGGTGGGTCTGCAATGGCGG + Intergenic
1190240560 X:48654920-48654942 CAATGGCGGGTCTGCGACGGCGG - Intergenic
1190368104 X:49716690-49716712 CAGTGGTGGGTCTGCAACGGTGG - Intergenic
1192571975 X:72213558-72213580 CAGCGATGGGTCTGCAACGGTGG - Intronic
1194154505 X:90370282-90370304 CAGTGGTGGGTCTGTGACAGTGG + Intergenic
1194445401 X:93981474-93981496 CAGCGGCGGGTCTGCGATGGTGG + Intergenic
1194753028 X:97705547-97705569 CATTGGCAGGCCTGCAAAAGTGG + Intergenic
1196772526 X:119309138-119309160 CAGTGGCGGGTCTGCAACGGCGG + Intergenic
1196993633 X:121356640-121356662 CAGTGGCGGGTCTGTGATGGTGG - Intergenic
1197999717 X:132420329-132420351 CAGCGGCGGGTCTGCGACGGCGG + Intronic
1198566840 X:137913893-137913915 CAGCGGCGGGTCTGCGACGGCGG + Intergenic
1198862330 X:141084365-141084387 CAATGGCGGGTCTGCGAGGGCGG - Intergenic
1198900364 X:141503021-141503043 CAATGGCGGGTCTGCGAGGGCGG + Intergenic
1199368804 X:147020903-147020925 CAGCAGCGGGTCTGCAACAGCGG - Intergenic
1199432076 X:147773185-147773207 CAGCGGCGGGTCTGTGACTGCGG - Intergenic
1200084279 X:153595732-153595754 CAGAGGCGGGGCTTCAGCAGAGG - Intronic
1201329230 Y:12800021-12800043 CAATGGTGGGTCTGCAATGGCGG - Intronic
1201905228 Y:19080334-19080356 CAGTGGCGGGTCTGTGATGGTGG - Intergenic