ID: 993590954

View in Genome Browser
Species Human (GRCh38)
Location 5:89794676-89794698
Sequence TCCATCCCTCCAGATCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993590949_993590954 16 Left 993590949 5:89794637-89794659 CCACTGCTGTTGGCCGCTGTTGC No data
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data
993590948_993590954 19 Left 993590948 5:89794634-89794656 CCACCACTGCTGTTGGCCGCTGT No data
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data
993590947_993590954 23 Left 993590947 5:89794630-89794652 CCATCCACCACTGCTGTTGGCCG No data
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data
993590951_993590954 -10 Left 993590951 5:89794663-89794685 CCCGCCACTGACTTCCATCCCTC 0: 32
1: 92
2: 135
3: 160
4: 426
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data
993590950_993590954 3 Left 993590950 5:89794650-89794672 CCGCTGTTGCAGACCCGCCACTG 0: 3
1: 6
2: 34
3: 74
4: 195
Right 993590954 5:89794676-89794698 TCCATCCCTCCAGATCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993590954 Original CRISPR TCCATCCCTCCAGATCCAAA AGG Intergenic
No off target data available for this crispr