ID: 993590956

View in Genome Browser
Species Human (GRCh38)
Location 5:89794677-89794699
Sequence CCATCCCTCCAGATCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993590952_993590956 -10 Left 993590952 5:89794664-89794686 CCGCCACTGACTTCCATCCCTCC 0: 15
1: 77
2: 95
3: 156
4: 634
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590949_993590956 17 Left 993590949 5:89794637-89794659 CCACTGCTGTTGGCCGCTGTTGC No data
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590950_993590956 4 Left 993590950 5:89794650-89794672 CCGCTGTTGCAGACCCGCCACTG 0: 3
1: 6
2: 34
3: 74
4: 195
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590951_993590956 -9 Left 993590951 5:89794663-89794685 CCCGCCACTGACTTCCATCCCTC 0: 32
1: 92
2: 135
3: 160
4: 426
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590948_993590956 20 Left 993590948 5:89794634-89794656 CCACCACTGCTGTTGGCCGCTGT No data
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data
993590947_993590956 24 Left 993590947 5:89794630-89794652 CCATCCACCACTGCTGTTGGCCG No data
Right 993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993590956 Original CRISPR CCATCCCTCCAGATCCAAAA GGG Intergenic
No off target data available for this crispr