ID: 993598089

View in Genome Browser
Species Human (GRCh38)
Location 5:89884736-89884758
Sequence CCTTCTGTACTCTAGCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993598089_993598095 5 Left 993598089 5:89884736-89884758 CCCAGTAGCTAGAGTACAGAAGG No data
Right 993598095 5:89884764-89884786 CTTCTCCACAGAAGCAGCATGGG No data
993598089_993598094 4 Left 993598089 5:89884736-89884758 CCCAGTAGCTAGAGTACAGAAGG No data
Right 993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993598089 Original CRISPR CCTTCTGTACTCTAGCTACT GGG (reversed) Intergenic
No off target data available for this crispr