ID: 993599825

View in Genome Browser
Species Human (GRCh38)
Location 5:89907938-89907960
Sequence TGGTACTATTGTCATTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1961
Summary {0: 2, 1: 26, 2: 370, 3: 679, 4: 884}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993599825_993599826 -6 Left 993599825 5:89907938-89907960 CCAAAACAATGACAATAGTACCA 0: 2
1: 26
2: 370
3: 679
4: 884
Right 993599826 5:89907955-89907977 GTACCATTAGAGATCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993599825 Original CRISPR TGGTACTATTGTCATTGTTT TGG (reversed) Intergenic
901132783 1:6972766-6972788 TTTTACTATTATTATTGTTTTGG + Intronic
901261114 1:7871756-7871778 TGTTACTATTCGAATTGTTTGGG + Intergenic
901289141 1:8108993-8109015 TGTTGCTGTTGTGATTGTTTTGG + Intergenic
901751031 1:11408779-11408801 CATTACTATTGTAATTGTTTTGG + Intergenic
901890937 1:12264092-12264114 TGTTATTATTGTATTTGTTTTGG + Intronic
901949455 1:12730517-12730539 TGTTACTACTGTAATTGTTTTGG - Intergenic
902165436 1:14567341-14567363 TATTACTATTATAATTGTTTTGG - Intergenic
902573585 1:17362582-17362604 GGGTACGATGTTCATTGTTTGGG + Intronic
902750706 1:18508121-18508143 GGGTACTATGTTCACTGTTTGGG + Intergenic
902928287 1:19712267-19712289 TGTTACTATTGTAATTGTTTTGG - Intronic
903092346 1:20932716-20932738 TGTTACTGTTGTAATTGTTTTGG - Intronic
903561134 1:24228735-24228757 TGTTACTATTGTAATTGCTTTGG - Intergenic
903598037 1:24511595-24511617 TGTTACCATTGTAATTGTTTTGG - Intronic
903636116 1:24817997-24818019 TGTTACTCTTGTAATTGTTTTGG - Intronic
903783747 1:25841840-25841862 TGTTACTATTGTAATTGTTTTGG + Intronic
903784033 1:25845163-25845185 AGAGACTATTGTCATAGTTTAGG - Intronic
903881118 1:26510163-26510185 TGTTACTATTGTGATTGTTTTGG + Intergenic
903900057 1:26637682-26637704 TGTTACTATTATTATTATTTTGG + Intergenic
904202497 1:28830204-28830226 TGCTACCACTGTAATTGTTTTGG - Intronic
904577792 1:31516481-31516503 TGTTTCTATTGTAATTGTTTTGG + Intergenic
904580901 1:31543607-31543629 TGTTACTATTGTAAAAGTTTGGG - Intergenic
904862955 1:33553346-33553368 TGTCACTATTGTAATTGTTTTGG + Intronic
904951841 1:34247945-34247967 TGTTACTATTGTAATTATTTTGG + Intergenic
905086215 1:35379914-35379936 TGTTACTATTGTAATTGTTTTGG - Intronic
905144157 1:35874088-35874110 TGTTACTATTGCAATTGTTTTGG + Intronic
905545898 1:38800530-38800552 TGTTACTATTATAATTGTTTTGG - Intergenic
905615533 1:39395047-39395069 CGGCACTATTGACATTTTTTGGG + Intronic
906558894 1:46739159-46739181 TGTTACCATTGTAATTGTTTTGG - Intergenic
906838932 1:49114858-49114880 TGCTACTATTGTAATTGTTTTGG - Intronic
907019453 1:51052203-51052225 TGTTATTATTGTAATTGTTTTGG - Intergenic
907034009 1:51200256-51200278 TGCTACTATTGAAATTGTTTTGG - Intergenic
907112901 1:51942917-51942939 TGTTACTATTGTAATTGCTTTGG + Intronic
907548112 1:55280029-55280051 TGTTACTGTTGTAATTGTTTTGG + Intergenic
907628101 1:56051441-56051463 TGTTAGTATTGTAATTGTTTGGG - Intergenic
907633164 1:56105590-56105612 TGTTACTATTGGGATTGTTGTGG - Intergenic
907858762 1:58329761-58329783 TGTTACTATTGCAACTGTTTTGG + Intronic
907965864 1:59328921-59328943 TGTTACTATTGCATTTGTTTTGG - Intronic
908333271 1:63093181-63093203 TGTTATTGTTGTCATTGTTTTGG - Intergenic
908579024 1:65494039-65494061 TGGTGCTATTGTTTTTGTTCTGG + Intronic
908722703 1:67143319-67143341 GGGTACTATTGTCTTATTTTTGG + Intronic
908849655 1:68362987-68363009 TGTTATTATTGTAATTGTTTTGG - Intergenic
908893201 1:68869055-68869077 TGTTATTATTGTTATTGTTTTGG - Intergenic
908975432 1:69891405-69891427 TACTACTATTGTAATTGTTTTGG - Intronic
909189097 1:72529784-72529806 TGTTACTATTTTAATTGTTTTGG + Intergenic
909220361 1:72951462-72951484 TGTTACTATTAAGATTGTTTTGG - Intergenic
909347290 1:74605722-74605744 TGTTACTATTGCAATTGTTTTGG - Intronic
909365817 1:74820596-74820618 AGTTACTATTGTAATTGTTTGGG - Intergenic
909715322 1:78701119-78701141 AGGAACTTGTGTCATTGTTTAGG + Intergenic
910071985 1:83227637-83227659 TATTACTATTGTAATTGTTTTGG + Intergenic
910076380 1:83284503-83284525 TGCTACTATTGTAATTATTTTGG + Intergenic
910078462 1:83309282-83309304 TGTTCCTATTGTGATTGTTTTGG - Intergenic
910231758 1:84995126-84995148 TGTGACTACTGTAATTGTTTTGG - Intronic
910411789 1:86953997-86954019 TATTACTATTGCAATTGTTTTGG - Intronic
910545738 1:88415358-88415380 TGCTACTATTGTAATTGTTTTGG - Intergenic
910640070 1:89450803-89450825 CGTTACTATTGGAATTGTTTTGG + Intergenic
910718636 1:90259994-90260016 TGTTACTGTTGTAATTTTTTGGG + Intergenic
910801371 1:91150122-91150144 TGTTACTATTATCACTGTTTTGG - Intergenic
910918325 1:92315332-92315354 TGTTACTGTTGTAATTGCTTTGG - Intronic
910983385 1:92980812-92980834 CAGTGCTATTGTTATTGTTTTGG + Intergenic
911043043 1:93607142-93607164 TGGTACAATGTTCATTATTTGGG + Intronic
911135630 1:94436752-94436774 TGTTACTATTGTAATTGTTTTGG + Intronic
911199115 1:95026605-95026627 TGTTATTGTTGTAATTGTTTGGG - Intronic
911296601 1:96125099-96125121 TGGTACTATTTTAATTGTTTCGG + Intergenic
911612069 1:99968699-99968721 TGTTACTATGGTAATTGTTTTGG - Intergenic
911649655 1:100373364-100373386 TATTACTACTGTAATTGTTTTGG - Intronic
911820151 1:102408765-102408787 TATTACTATTATAATTGTTTTGG + Intergenic
911831999 1:102562145-102562167 TGTTACTGTTATGATTGTTTTGG + Intergenic
911833871 1:102590526-102590548 TGTTACTATAGTAATTGTCTTGG - Intergenic
911868429 1:103058915-103058937 TGTTACAGTTGTAATTGTTTTGG + Intronic
911897046 1:103449293-103449315 TGTTACTACTGTAACTGTTTTGG - Intergenic
911928943 1:103875276-103875298 TGTTACTATTTTAATTATTTTGG - Intergenic
911968541 1:104399318-104399340 TGGTACTGTTATAACTGTTTTGG - Intergenic
911980978 1:104565697-104565719 TGCTATTATTGTAATTGTTTGGG - Intergenic
912152451 1:106877037-106877059 TTGTACTATTGTGTTTATTTTGG + Intergenic
912307164 1:108580195-108580217 TGTTACTGTTGTAATTGTTTTGG + Intronic
912563622 1:110568278-110568300 TTGTACTATTTCCATTGTTTTGG + Intergenic
912859541 1:113201044-113201066 TGTTACTATTATGATTGTTTTGG + Intergenic
913127036 1:115801177-115801199 TGTTGCTATTGTAATTGTTTTGG - Intergenic
913207345 1:116552317-116552339 TGTTACTGTTGTCATTGTTTTGG - Intronic
914356935 1:146894595-146894617 TGTTACTATTGTAATTGTTTTGG - Intergenic
914709746 1:150202260-150202282 TGTTAGTATTGTAATTATTTTGG - Intergenic
914776281 1:150738721-150738743 TATTACTATTGTAATTGTCTTGG + Intronic
914977142 1:152377071-152377093 TGTTACTATTGTAATTGTTTTGG + Intergenic
915032192 1:152890450-152890472 TGTTACTATTGCATTTGTTTTGG - Intergenic
915133201 1:153710862-153710884 TGATACTGTTGTCAAAGTTTTGG - Intergenic
915845299 1:159257424-159257446 TGTTACTATTGTAATTGTTTTGG - Intergenic
916169728 1:161992784-161992806 AATTACTATTTTCATTGTTTTGG - Intronic
916304287 1:163311718-163311740 TGTTACTATTATAATTGTTTTGG - Intronic
916468784 1:165101363-165101385 TTTTACTACTGTAATTGTTTTGG + Intergenic
916566661 1:165984819-165984841 TGTTACTATTATAATTGTTTTGG + Intergenic
916669314 1:166998917-166998939 TGTTACTATTGTAATTGTTTTGG + Intronic
916778816 1:168000238-168000260 TCTTACTATTGTAATTGCTTTGG - Intronic
916831905 1:168501901-168501923 TATTACTATTATAATTGTTTTGG - Intergenic
916956897 1:169847134-169847156 TGTTACTATTGTCATTGTTTTGG - Intronic
917192297 1:172430924-172430946 TGTTACCATTGCAATTGTTTTGG + Intronic
917238972 1:172926482-172926504 TATTACTATTGTAATTGTTTGGG - Intergenic
917353280 1:174100725-174100747 TGTTACTATTGTAATTGTTTTGG - Intergenic
917353519 1:174102828-174102850 TGTTACTATTGTAATTGTTTTGG + Intergenic
917766243 1:178220414-178220436 TGTTACTACTGTAATTGTTTGGG - Intronic
917861412 1:179148467-179148489 TGTCACTACTGTCATTGTTTTGG + Intronic
917983943 1:180295698-180295720 TGTTACTATTGTAATTTTTTGGG + Intronic
917993518 1:180409599-180409621 TGTTACTATTGTAATTGTTTTGG + Intronic
918392091 1:184076316-184076338 TGTTACTATTGTAATTGTTTTGG + Intergenic
918582698 1:186149938-186149960 TGTTACTATTGTAATTGTTTTGG - Intronic
918606172 1:186428898-186428920 TGTCACTATTATAATTGTTTTGG - Intergenic
918632540 1:186735222-186735244 CGGTACTATTGTAATTGTTTGGG - Intergenic
918699838 1:187594541-187594563 TGTTACTATTGTAATTATTTTGG - Intergenic
918868044 1:189929446-189929468 TTGTAATAGTGTCATTGTCTGGG + Intergenic
918877394 1:190065760-190065782 TGTTATTATTGTAATTGTTTTGG - Intergenic
919093911 1:193006752-193006774 TGTTACTATTGTAATTGTTTTGG - Intergenic
919113293 1:193247275-193247297 TGTTACTATTAAAATTGTTTTGG + Intronic
919123422 1:193368854-193368876 TGATATTATTGTAATTGTTTGGG - Intergenic
919204083 1:194397667-194397689 TGTTACTATTATAATTGTTTGGG - Intergenic
919281204 1:195491479-195491501 TATTTCTATTGTGATTGTTTTGG - Intergenic
919335658 1:196229323-196229345 TGTTCCTATTGTAATTGTTTTGG + Intronic
919365344 1:196653392-196653414 AGGTAATATTGACATTGTTCTGG - Intronic
920064161 1:203254230-203254252 TGTTACTATTGTAATTGTTTTGG + Intronic
920447078 1:206025874-206025896 TGTTACTGTTGTAATTGTTTTGG + Intergenic
920619914 1:207534908-207534930 TGTTACTATTGTCATTGTTTGGG + Intronic
920621695 1:207553463-207553485 TGTTACTATTGTCATTGTTTGGG + Intronic
920623321 1:207570558-207570580 TGTTACTATTGTCATTGTTTGGG + Intronic
920809839 1:209273336-209273358 TGGTATTATGGTCACTCTTTGGG - Intergenic
920887561 1:209946039-209946061 TGCTACTATTGTAATTGTTTTGG + Intronic
921091056 1:211843515-211843537 TGTTACTATTGTAATTGTTTTGG - Intergenic
921141872 1:212315921-212315943 TGTTACTATTGTAATTGTTTTGG + Intronic
921224407 1:213003625-213003647 TATTACTATTGTAATGGTTTTGG - Intronic
921225985 1:213019764-213019786 TGTTACTATTGTAATTGTTTTGG + Intergenic
921233652 1:213100530-213100552 GGGTACTATATTCATTATTTGGG - Intronic
921278328 1:213541272-213541294 TGTTACCATTGTAATTGTTTGGG - Intergenic
921281998 1:213576539-213576561 TATTACTATTGTAATTGTTTGGG + Intergenic
921301689 1:213756965-213756987 TGATATTATTTTTATTGTTTTGG + Intergenic
921313888 1:213872491-213872513 TGTTATTATTATCATTGTTTTGG + Intergenic
921402637 1:214743153-214743175 TGTTACTATTGTCATTGTTTGGG - Intergenic
921571661 1:216787130-216787152 TGTTACTGTTGTAATTGTTTTGG + Intronic
921585532 1:216942012-216942034 CGGTACTATGTTCACTGTTTGGG - Intronic
921593745 1:217032773-217032795 TGAAAATATTCTCATTGTTTGGG + Intronic
921609813 1:217198163-217198185 TGTTGCTATTGTAATTGTTTTGG - Intergenic
921761548 1:218921061-218921083 TATTACTATTGTAGTTGTTTGGG - Intergenic
921828838 1:219704228-219704250 TGTTACTATTGTAATTGTTTTGG + Intronic
921908139 1:220517120-220517142 TGTTACTATTGTAATTCTTTTGG + Intergenic
922012580 1:221606115-221606137 TGTTACCATTGTAATTGTTTTGG + Intergenic
922026262 1:221751951-221751973 TGGTACAATTCTCATCTTTTAGG - Intergenic
922190143 1:223311443-223311465 TAGTATTATTATCATTATTTTGG - Intronic
922389555 1:225126085-225126107 TGTTACTATTGTAATTGTTTGGG - Intronic
922495756 1:226056615-226056637 TGTTACTATTGTAATTGTCTTGG - Intergenic
922588623 1:226755113-226755135 TGTTCCTACTGTAATTGTTTTGG + Intergenic
922651349 1:227341705-227341727 TGTTACTATGGTAATTGTTTTGG - Intergenic
922659171 1:227414206-227414228 TGTTACTGTTGTAATTGTTTTGG - Intergenic
922959247 1:229631742-229631764 TGTTACTATTCTAATTGTTTTGG - Intronic
923179890 1:231506539-231506561 TGTTACTACTGTAATTATTTTGG - Intergenic
923717818 1:236440742-236440764 TGTTACTATTGTAATTGTTTTGG + Intronic
923763144 1:236866314-236866336 TGTTACTATTTTAATTGTTTTGG + Intronic
923885320 1:238148291-238148313 TGGTAATACTGTCATATTTTTGG - Intergenic
924080559 1:240393359-240393381 TGTTACTATTGTAATTGTTCTGG + Intronic
924301016 1:242637982-242638004 TGTTGCTATTGTCATTGTTTTGG + Intergenic
924409680 1:243790915-243790937 TGTTACTGTTGTAATTGTTTTGG - Intronic
924689439 1:246331871-246331893 TGTTACTACTGTAATTGTTTTGG + Intronic
924833364 1:247622291-247622313 TGTTACTATTGTATTTGTTTCGG + Intergenic
1062866055 10:855587-855609 TTGTACTACTGCCATTGTTTTGG - Intronic
1062933087 10:1365252-1365274 TGTTACTATGGTGATTGTCTTGG + Intronic
1063220224 10:3960443-3960465 TTGTAGTATTTTCATTATTTTGG + Intergenic
1063247050 10:4232042-4232064 TGTTACTATTGACCTTGTTTTGG + Intergenic
1063264568 10:4433757-4433779 TGTCACTATTGTAATTGTTTTGG - Intergenic
1063519232 10:6725939-6725961 TGGTGCTATAGTCATCCTTTTGG + Intergenic
1063678797 10:8166007-8166029 TGCTACTATTTTCATTTCTTAGG + Intergenic
1063802031 10:9590842-9590864 TGTTACTATTGTCATTATTTTGG - Intergenic
1063804037 10:9616861-9616883 TATTACTATTGTAGTTGTTTTGG - Intergenic
1063825036 10:9886699-9886721 TGTTACTATTGTAATTATTTTGG - Intergenic
1064191916 10:13214062-13214084 TGTTACTATTGTAATTGTTTTGG + Intergenic
1064627936 10:17280701-17280723 TGGTAGTAATGCCAATGTTTGGG + Intergenic
1065120056 10:22520597-22520619 TATTACTATTGTAATTGTTTGGG + Intergenic
1065410906 10:25426666-25426688 TGTTACTCTTGTAATTGTTCTGG - Intronic
1065413698 10:25460948-25460970 TGTTACTATTGTAATTGTTTTGG + Intronic
1065439505 10:25736539-25736561 TGTTAGTATTTTAATTGTTTTGG + Intergenic
1065687315 10:28299463-28299485 TGTTACGATTCTAATTGTTTTGG - Intronic
1066050876 10:31633742-31633764 TGTTACTATTGTAATTATTCTGG + Intergenic
1066123322 10:32313148-32313170 TGATTCCATTGTCATTGGTTCGG - Intronic
1066134957 10:32436197-32436219 TGTTACTATTGTAATTGTTTTGG - Intergenic
1066237938 10:33505160-33505182 AGTTACTATTGTAATTGTTTTGG - Intergenic
1066266878 10:33784562-33784584 TGTTACTTTTGTAATTGTTTGGG + Intergenic
1066285595 10:33962982-33963004 TGTTACTATTATAATTGTTTTGG - Intergenic
1066323749 10:34332208-34332230 TGGTACTATTGGTATTATCTTGG - Intronic
1066324333 10:34341395-34341417 TAGTAGTTTTGTCATTGTTTTGG + Intronic
1066531172 10:36341254-36341276 TGTTACTATCGTGATTGTTTTGG + Intergenic
1066717596 10:38303274-38303296 GGGTACTATGTTCACTGTTTGGG + Intergenic
1067304496 10:45048287-45048309 AGGTACTATGCTCATTATTTGGG + Intergenic
1067960822 10:50847046-50847068 AGGTACTATTTTCATAGTTGAGG + Intronic
1067990657 10:51208318-51208340 TGGTAAAATTGTTATGGTTTAGG + Intronic
1068081376 10:52322132-52322154 GGTTACAATTGTAATTGTTTTGG + Intergenic
1068127080 10:52853672-52853694 TGTTATTATTTTAATTGTTTTGG + Intergenic
1068197721 10:53739813-53739835 TGTTACTATTGTAATTGTTTTGG - Intergenic
1068281389 10:54875223-54875245 TGTTACTATTGTAATTGTTTTGG + Intronic
1068283461 10:54907579-54907601 TGTTGCTATTGTCATTGTTAAGG + Intronic
1068573887 10:58661566-58661588 TGCTATTATTGACAATGTTTAGG + Intronic
1068700399 10:60013791-60013813 TGTTACTATTTTAATTGTTTTGG - Intergenic
1069012033 10:63385205-63385227 TGTTAGCATTGTAATTGTTTTGG - Intronic
1069087153 10:64154242-64154264 TGTTACTATTGTAATTGTTTTGG - Intergenic
1069304034 10:66945938-66945960 TGTTACTACTGTAATTGTTTTGG - Intronic
1069319076 10:67145165-67145187 TGTTATTATTGTAATTATTTTGG - Intronic
1069342918 10:67433334-67433356 TGTTACTACTGTAATTGTTTTGG - Intronic
1069417757 10:68216281-68216303 TGTTGCTATTGTAATTGCTTTGG + Intergenic
1069736369 10:70657601-70657623 TGTTACTATTGTAATTATTTTGG + Intergenic
1069947210 10:71995778-71995800 TGTTACTATTGTAAGTGTTTTGG - Intronic
1070218550 10:74414041-74414063 TATTATTATTGTAATTGTTTTGG - Intronic
1070462050 10:76680129-76680151 TAGTATTATTGTTGTTGTTTTGG - Intergenic
1071142237 10:82522450-82522472 TGTTATTATTGTGGTTGTTTTGG - Intronic
1071226163 10:83530737-83530759 TGTTACCATTGTAATTGTTTGGG - Intergenic
1071438816 10:85671436-85671458 TGTTACTATTGTGATTCTTTGGG + Intronic
1071663017 10:87524846-87524868 TGTTACTTTTGTAATTGTTTTGG - Intronic
1071683293 10:87729424-87729446 TGTTACTATTGTAATTGTTTTGG + Intronic
1071691743 10:87827591-87827613 TGTTACTATTGTGATTGTTCTGG + Intronic
1071854262 10:89607389-89607411 TGTCACTATTGTAATTGTTTTGG - Intronic
1072094800 10:92167599-92167621 TGTAACTATTGTAATAGTTTTGG - Intronic
1072145790 10:92635566-92635588 TGTTACTATTGTAATTGTCTTGG - Intronic
1072151080 10:92684573-92684595 TGTTACTATTGTAATCGTTTTGG + Intergenic
1072184799 10:93026694-93026716 TGTTACCATTGTAATTGTTTTGG + Intronic
1072279829 10:93855695-93855717 TGGGACTTTTGCCGTTGTTTTGG + Intergenic
1072344489 10:94489870-94489892 TGTTACTATTCTCATTGTTTTGG - Intronic
1072410901 10:95201268-95201290 TGGTACTATGGTCACTGTTTGGG - Intronic
1072836323 10:98717681-98717703 TGCTGCTATTGTAATTATTTTGG - Intronic
1072912696 10:99518093-99518115 TAATACTATTGTAATTATTTTGG - Intergenic
1073654703 10:105400613-105400635 TGTTACTGTTGTTGTTGTTTTGG - Intergenic
1073715424 10:106101180-106101202 TGGGACAACTGTCTTTGTTTAGG - Intergenic
1074201508 10:111240217-111240239 TGTTAGTATTGTAATTGTTTGGG - Intergenic
1074210689 10:111331431-111331453 TGTTAGTATTGTGATTGTTTTGG + Intergenic
1074287440 10:112111234-112111256 TGGCACTATTGACATTTTTGGGG - Intergenic
1074468071 10:113701854-113701876 TGTTACTATTGTAATTGCTTTGG + Intronic
1074607299 10:114985956-114985978 TGTAACTATTGTAATTGTTTGGG - Intergenic
1074649831 10:115508177-115508199 TGTTACTTTTGTAATTGTTTTGG + Intronic
1074905278 10:117856943-117856965 TGTTGCTATTTTAATTGTTTTGG - Intergenic
1075010103 10:118860544-118860566 TGTTACTATTGTAATTGTTTTGG + Intergenic
1075034790 10:119055368-119055390 TGTTACTGTTGTAATTATTTTGG - Intronic
1075180348 10:120205304-120205326 TGTTACTATTGTAATTGTTTGGG - Intergenic
1075186161 10:120259838-120259860 TGTTACTATTGTAAATGTTTTGG - Intergenic
1075490726 10:122866655-122866677 TGTTACTATTGCCATTGTTTTGG + Intronic
1075751303 10:124773700-124773722 TATTACTATTGTAATTGTTTTGG - Intronic
1076095403 10:127731207-127731229 TGTTACTATTGTAATCATTTTGG - Intergenic
1076276474 10:129203577-129203599 TGTTACTATTGCAAATGTTTGGG - Intergenic
1076549583 10:131269644-131269666 TGCTACTATTGTGATTGTTTTGG - Intronic
1076808198 10:132870132-132870154 GGTTACCATTGTAATTGTTTTGG + Intronic
1077347320 11:2068943-2068965 GGTTACTATTATCATTGTTTTGG - Intergenic
1077605148 11:3604877-3604899 TGTTACTATTGTAACTGTTTTGG - Intergenic
1077683581 11:4269891-4269913 ATGTACTGTTGTCAGTGTTTTGG - Intergenic
1077686459 11:4296872-4296894 ATGTACTGTTGTCAGTGTTTTGG + Intergenic
1077691613 11:4348060-4348082 ATGTACTGTTGTCAGTGTTTTGG + Intergenic
1077749528 11:4950204-4950226 TGGTAATATTTTCATGATTTGGG + Intronic
1078117731 11:8470834-8470856 TGTTACTATTGTACTTGTTTGGG - Intronic
1078193675 11:9115995-9116017 TGTTACTATTGTCATTGTTTTGG - Intronic
1078805180 11:14692615-14692637 TGTTACTACTGTAATTGTTTTGG + Intronic
1078847917 11:15138179-15138201 TATTACTATTGTAGTTGTTTTGG - Intronic
1078951039 11:16134669-16134691 TGTTACTATTGTAGTTGTTTTGG + Intronic
1078975869 11:16475600-16475622 TGTTACTATTGTAATTATTATGG - Intronic
1078995888 11:16698859-16698881 TGTTACTATTATAATTATTTTGG - Intronic
1079132928 11:17759758-17759780 TGCTACTATTGTAATTGTTTTGG - Intronic
1079434966 11:20438520-20438542 GGGTACTAGAGTCATTGTGTAGG + Intronic
1079722457 11:23834912-23834934 TGTTATTATTATAATTGTTTTGG - Intergenic
1079776514 11:24537085-24537107 TGTTACTATTGTAATTATTTTGG - Intronic
1079801070 11:24869651-24869673 TGATATTATTGTAAATGTTTTGG + Intronic
1080064436 11:27994121-27994143 TGTTACTATTGGAATTGTTTTGG + Intergenic
1080143709 11:28953629-28953651 AGTTACTATTGTGATTGTCTTGG + Intergenic
1080543853 11:33296663-33296685 TGTTACTATTATAATCGTTTTGG + Intronic
1080829975 11:35883714-35883736 TGGTTCTATTTTGAATGTTTTGG + Intergenic
1080884772 11:36356681-36356703 TGTTACCATTGTAATTGTTTTGG + Intronic
1081162137 11:39762006-39762028 TGTTACTATTGTAATTGTTTGGG - Intergenic
1081176647 11:39935285-39935307 TGTTACTATTGTCATTGTTTTGG + Intergenic
1081233373 11:40614901-40614923 TGTTGCTATTGTAATTGTTCTGG - Intronic
1081256430 11:40902265-40902287 TGTTACTGTTGTTATTGTTTTGG + Intronic
1081266168 11:41024971-41024993 TCTTATTATTGTAATTGTTTTGG + Intronic
1081457298 11:43236543-43236565 TGTTACTACTGTAATTGTTTTGG + Intergenic
1081485746 11:43526880-43526902 TATTACTGTTGTAATTGTTTTGG - Intergenic
1081652824 11:44835881-44835903 TGTTACTGTTGTAATTGTTTGGG + Intronic
1081948391 11:47019668-47019690 TGTTATTATTGTAATTATTTTGG - Intronic
1082205351 11:49427070-49427092 TGTCACTCTTGTAATTGTTTTGG + Intergenic
1082662814 11:55934078-55934100 TGTTACTATTATCATTATTTAGG - Intergenic
1082761853 11:57134899-57134921 TGTTATTACTGTAATTGTTTTGG - Intergenic
1082880847 11:58036130-58036152 TGTCACTATTGTCATTGTTTTGG + Intronic
1083040141 11:59677967-59677989 TGTTACTATTTTAATTGTTTTGG - Intergenic
1083071455 11:59987623-59987645 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1084486654 11:69452106-69452128 TGTAACTATTGTCATGGTTGGGG - Intergenic
1084668158 11:70588018-70588040 TGCTTCTATTGTAATTGTTTTGG + Intronic
1084738860 11:71124995-71125017 TGTTACTATTGTCATTGTTCTGG + Intronic
1085234065 11:74998199-74998221 TGTTATTACTGTAATTGTTTTGG - Intronic
1085436519 11:76509046-76509068 TGTTACTATTATAATTGTTTTGG - Intronic
1085608578 11:77925290-77925312 TGTTACTGTTGTAATTGTTTTGG - Intronic
1086034560 11:82401027-82401049 TGTTACTACGGTAATTGTTTTGG - Intergenic
1086081969 11:82913002-82913024 TGTTACTATTGTAATTGTTTTGG - Intronic
1086121660 11:83311086-83311108 TGCTACTACTGTAATTGTTTTGG - Intergenic
1086323577 11:85675511-85675533 TACTACTATTGTAATTGTTTGGG - Intronic
1086468512 11:87080247-87080269 TGGCACTATTGACATGTTTTGGG + Intronic
1086617747 11:88843423-88843445 TGCTACTGTTGTAATTGGTTTGG + Intronic
1086649753 11:89273466-89273488 TGTCACTCTTGTAATTGTTTTGG - Intronic
1086742552 11:90385643-90385665 TGGTTCTATTTTCAATGTATTGG - Intergenic
1086774719 11:90816029-90816051 AGGTACCAATGTCATTCTTTTGG - Intergenic
1086775150 11:90821463-90821485 AGTTACTAATGTAATTGTTTTGG - Intergenic
1086787435 11:90987143-90987165 TGGAACTATTATCATTATCTAGG + Intergenic
1086896981 11:92324559-92324581 TGTTACTATTGTAATTGTCTTGG - Intergenic
1087027839 11:93668664-93668686 TGGTACTGTTGTCATGCTCTGGG + Intronic
1087064493 11:94014803-94014825 TGTTACCACTGTAATTGTTTGGG + Intergenic
1087156056 11:94905179-94905201 TGTTACTATTGTGATTGTTTTGG - Intergenic
1087190401 11:95248708-95248730 TGCTACTTTTGTCATCCTTTGGG + Intergenic
1087478649 11:98670710-98670732 TGATACTATTGTAATTGTCTTGG + Intergenic
1087540561 11:99512702-99512724 TGTCACTATTGTAATTGTTTTGG + Intronic
1087609446 11:100416146-100416168 TGTTACTATTGTAATTGTTTTGG - Intergenic
1087657819 11:100946704-100946726 TATTACTATTGTCATTATTTTGG - Intronic
1087735928 11:101833730-101833752 TTGTACTATTGTAATCGTTTGGG + Intronic
1088156982 11:106818368-106818390 TGTTACTATGGTAATTGTTTTGG + Intronic
1088230987 11:107672951-107672973 TTGTACTATTTTGATTGTATTGG - Intergenic
1088518505 11:110666779-110666801 TGTTACTATTGTAATTGTTTTGG + Intronic
1090218230 11:124990299-124990321 TGTTACTATCCTAATTGTTTTGG - Intronic
1090260921 11:125319269-125319291 TGTTATTATTGTAATTATTTTGG - Intronic
1090468906 11:126960977-126960999 TGTTAATATTGTAATTGTTTTGG + Intronic
1090523114 11:127500050-127500072 CGCTACTGTTGTAATTGTTTTGG + Intergenic
1090813097 11:130265000-130265022 TGTTACTACTGTAATTGTTTTGG + Intronic
1091110057 11:132957761-132957783 TGTTACTATTTTAATTGTTTTGG + Intronic
1091427108 12:400692-400714 TATTACTATTATAATTGTTTAGG - Intronic
1092364424 12:7865183-7865205 TATTACTATTGTCATTGTTTTGG + Intronic
1092382147 12:8005544-8005566 TATTACTATTGTCATTGTTTTGG + Intergenic
1092599985 12:10050205-10050227 TGTTACTGTTATAATTGTTTGGG - Intronic
1092600522 12:10057564-10057586 TAGAACCATTGTTATTGTTTTGG + Intronic
1092824014 12:12380142-12380164 TGTCACTATTGTAATTGTTTTGG - Intronic
1092966161 12:13645375-13645397 TGTTACTACTGTAATTGTTTTGG - Intronic
1093002578 12:14014335-14014357 TGTTACTATTATAATTGTTTTGG - Intergenic
1093221904 12:16431625-16431647 TGTTACTATTGCAATTCTTTTGG - Intronic
1093575149 12:20719172-20719194 TGTTAGTATTGTAATTGTTTTGG + Intronic
1093650828 12:21643863-21643885 TGTTTCTGTTGTTATTGTTTTGG - Intronic
1093658371 12:21723992-21724014 TGTCACTATTGTAATTGTCTGGG + Intronic
1093662000 12:21767965-21767987 TGTCATTATTGTAATTGTTTAGG + Intronic
1093687032 12:22068504-22068526 TGTTACTGTTGTAATTGTTTTGG - Intronic
1093691168 12:22110844-22110866 TGTTACTATTGTAATTGTTATGG - Intronic
1093721307 12:22445034-22445056 TAGTACTATTTTCAATTTTTTGG - Intergenic
1093821132 12:23619028-23619050 TGCTATTATTGTTGTTGTTTTGG + Intronic
1093838290 12:23864153-23864175 TGTTTGTATTGTAATTGTTTTGG + Intronic
1094010964 12:25809019-25809041 TGGTACTATGTTCACTATTTGGG + Intergenic
1094205338 12:27833772-27833794 TGTTACTATTATAAATGTTTTGG + Intergenic
1094280123 12:28727670-28727692 TGTTACTATTATAATTGTTTTGG - Intergenic
1094280674 12:28734162-28734184 TGTTACTATTATGATTGTTTTGG + Intergenic
1094572042 12:31649690-31649712 TGTTTCTATTGTAATTGTTTTGG + Intronic
1094636978 12:32236054-32236076 TGTTACTATTGTAATTGTTTGGG + Intronic
1095168744 12:39007591-39007613 TGTTAGTATTGTAATTATTTGGG + Intergenic
1095312033 12:40710363-40710385 TTTTACTATTGTAATTGTTTTGG - Intronic
1095466963 12:42497611-42497633 TGTTACTATTTTAATTGTTTTGG - Intronic
1095523072 12:43091551-43091573 TGTTACTATTGTAATTGTTTTGG + Intergenic
1095719403 12:45384683-45384705 TGTTACTATTGTAATTGTTTTGG - Intronic
1095729018 12:45485434-45485456 TGTTACTATTGTAATTGTTTTGG + Intergenic
1095772449 12:45975857-45975879 TGTTATTATTGTAATTATTTTGG - Intronic
1095791240 12:46169680-46169702 TGTTACTATTGTAATTGTTTTGG - Intergenic
1095936884 12:47693335-47693357 TGTTTCTATTGTAATTGTTTTGG - Intronic
1096013245 12:48241741-48241763 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1096129941 12:49150209-49150231 TGTTACTATTGTAATGGTTTTGG + Intergenic
1096432151 12:51554831-51554853 TGTCACTATTGTCATTGTTTTGG - Intergenic
1096440315 12:51637100-51637122 TGTTACTATTGTAATTGTTCTGG + Intronic
1096906219 12:54938449-54938471 TGTTACTATTGTACTTGTTTTGG + Intergenic
1097123673 12:56755674-56755696 AGGTACTATTGTAATTGTTTGGG - Intronic
1097387051 12:58962510-58962532 GGGTACTATGTTCATTATTTGGG + Intergenic
1097518162 12:60633590-60633612 TGTTACTATTACCATTGTTTGGG + Intergenic
1097936493 12:65257694-65257716 TGTTACTATCATAATTGTTTTGG - Intergenic
1098075212 12:66722457-66722479 TCTTACTATTTTAATTGTTTTGG - Intronic
1098172072 12:67757280-67757302 TGATTCTATTTTAATTGTTTTGG + Intergenic
1098206665 12:68118094-68118116 TGTCACTATTGTAATTGTTTTGG - Intergenic
1098344421 12:69486358-69486380 TGTTACTATTGTAATTGTTTTGG + Intronic
1098427402 12:70380317-70380339 TGTTACTATTATAATTGCTTTGG - Intronic
1098575805 12:72040869-72040891 TGTTAGCATTGTAATTGTTTGGG - Intronic
1098712813 12:73787138-73787160 TGTTACTATTGTAATTGTTTTGG - Intergenic
1098744245 12:74215566-74215588 TGTCACTATTGTGATTGTTTTGG - Intergenic
1098773228 12:74581549-74581571 TGGTACTATTTCTATTGTCTGGG + Intergenic
1098785662 12:74751064-74751086 TGCTACTATTGTAATTGTTTTGG + Intergenic
1098921787 12:76309285-76309307 TGTAACTATTGTAATTGTTTTGG - Intergenic
1099218342 12:79880968-79880990 TGTTACTATTTCAATTGTTTTGG + Intronic
1099480937 12:83165561-83165583 TGTTACTATTGTAATTATTTGGG - Intergenic
1099484476 12:83211452-83211474 TGGGAATATTTTCATTCTTTAGG - Intergenic
1099592401 12:84611481-84611503 TGTTACTACTGTAATAGTTTTGG + Intergenic
1099789498 12:87314121-87314143 TGTCACTATTGCAATTGTTTTGG + Intergenic
1099820830 12:87707198-87707220 TGTTATCATTGTAATTGTTTTGG - Intergenic
1099937931 12:89150388-89150410 TGTTACTACAGTAATTGTTTTGG + Intergenic
1100069214 12:90690876-90690898 TGTTAGTGTTGTAATTGTTTGGG + Intergenic
1100117507 12:91325279-91325301 TGTTACTGTTGTAATTATTTTGG - Intergenic
1100169217 12:91954555-91954577 TGTTGCTATTGTAATTGTTCTGG + Intergenic
1100468263 12:94868018-94868040 TGATACTATTGTAATTGTTTCGG + Intergenic
1100520747 12:95373423-95373445 TGTTACAATTGTTAGTGTTTTGG - Intergenic
1100618717 12:96251213-96251235 TACTACTATTGTCATTGTTTTGG + Intronic
1100922861 12:99509048-99509070 TGTTACTGTTGTAATTGTTTTGG + Intronic
1100927309 12:99563562-99563584 TACTACTATTGTAATTGTTTTGG - Intronic
1101483159 12:105122739-105122761 TGTTACTATTGTAATTGTTCTGG + Intronic
1101685014 12:107010762-107010784 TGCTACTATTGTAATTGTTTTGG + Intronic
1101886947 12:108672829-108672851 TGTTACTACTGTAATTGTTTCGG + Intronic
1101934914 12:109049452-109049474 TGTTACTATTGTAATTGTTTTGG - Intronic
1103048115 12:117755466-117755488 TGTCACTATGGTAATTGTTTTGG + Intronic
1104113605 12:125727247-125727269 TGTTACTAGTGTAATTATTTTGG + Intergenic
1104144093 12:126016329-126016351 TGTTACTATTGAAATTGTTTTGG - Intergenic
1105325063 13:19363362-19363384 TGTTACTGTTGCAATTGTTTTGG - Intergenic
1105337731 13:19489150-19489172 TGTTACTATTGTAATTGTTTTGG - Intronic
1105393000 13:19999426-19999448 TGTTACTATTGTAATTGTTTTGG + Intronic
1105397910 13:20057807-20057829 TGGTTCAGTAGTCATTGTTTGGG + Intronic
1105554782 13:21436539-21436561 CGTTACTATTGTAATTGTTTTGG + Intronic
1105589629 13:21779357-21779379 TGTTACTATTGTAATTGTTTTGG + Intergenic
1105747021 13:23386966-23386988 TGTCACTATTGTAATTGTTTTGG - Intronic
1105780047 13:23697612-23697634 TGTTACTATTGTAACTATTTTGG + Intergenic
1105833528 13:24187674-24187696 TGTTACTATTGTAATTGTTTTGG + Intronic
1105998572 13:25696918-25696940 TGTTACTATTGAAATTGTTTTGG - Intronic
1106071638 13:26417547-26417569 TGCTACTATTGTAATTGTTCTGG + Intergenic
1106177404 13:27342961-27342983 AGGTACTATTCTCACTATTTGGG - Intergenic
1106456597 13:29933256-29933278 TGTTACTATTGTAATTGTTTTGG - Intergenic
1106497492 13:30293949-30293971 TGTTACTGTTGTAATTGTATTGG + Intronic
1106915496 13:34509473-34509495 TGTTATTACTGTAATTGTTTTGG - Intergenic
1106946643 13:34835186-34835208 TGTTACTATTGTAAATGTTTCGG + Intergenic
1106987724 13:35374333-35374355 TGCTACTACTGTAATTGTTTTGG - Intronic
1107068728 13:36245965-36245987 TGTTACTACTGTAATTGTTTTGG + Intronic
1107074324 13:36305482-36305504 AGGTACTATTCTCAATGTTTAGG - Intronic
1107175308 13:37393095-37393117 TGTTACTATTTTAGTTGTTTTGG + Intergenic
1107194197 13:37628186-37628208 CATTACTATTGTCATTGTTTGGG + Intergenic
1107257890 13:38452422-38452444 TGTTACTATTGTAATTATTTGGG + Intergenic
1107287311 13:38808695-38808717 TGTTACTATTGTAATTATTTTGG - Intronic
1107689621 13:42939642-42939664 TGTTACTATTGTAATTGTTTTGG - Intronic
1107991653 13:45824024-45824046 TGGTACTATGTTCACTGTTTGGG - Intronic
1108147656 13:47496683-47496705 TGGTGACATTGTCAGTGTTTGGG - Intergenic
1108277976 13:48830889-48830911 TGTTACTATTGTAATTGTTTTGG + Intergenic
1108633020 13:52304523-52304545 CGTTACTATTGTAATTGTTTGGG - Intergenic
1108653671 13:52508032-52508054 CGTTACTATTGTAATTGTTTGGG + Intergenic
1108770618 13:53696143-53696165 TGTTACTATTGTAATTGTTTTGG + Intergenic
1108801678 13:54104322-54104344 TGTAACTATTCTAATTGTTTTGG - Intergenic
1108845100 13:54668602-54668624 TATTACTATTGTAATTGTTTTGG - Intergenic
1108962697 13:56255939-56255961 TGTTACTATTGTACTTATTTTGG + Intergenic
1109077192 13:57851207-57851229 TGTTGCTACTGTAATTGTTTGGG - Intergenic
1109131262 13:58589139-58589161 TGTCACTATTGTAATTGTTTTGG + Intergenic
1109265894 13:60199818-60199840 TGTTACTATTGTCATTGTTTTGG - Intergenic
1109350464 13:61174063-61174085 TGTTACTATTGTGATTGTTTTGG + Intergenic
1109408937 13:61939493-61939515 TGGTACTATGTTCAATCTTTGGG - Intergenic
1109459261 13:62633436-62633458 TGATATTATTGTAGTTGTTTTGG - Intergenic
1109515486 13:63438455-63438477 TGATGCTATTGTAATTGTTGTGG - Intergenic
1109533035 13:63678131-63678153 TGTTACTATTGTAATTATTTGGG - Intergenic
1109577589 13:64282239-64282261 GGGTACTATGGTTATTATTTGGG + Intergenic
1109681878 13:65762578-65762600 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1109700804 13:66022403-66022425 TGTTACTGTCGTGATTGTTTTGG + Intergenic
1109841307 13:67920285-67920307 GGGTACTATTTTCACTATTTGGG + Intergenic
1109893448 13:68650800-68650822 TGTTACTTTTGTAATAGTTTTGG + Intergenic
1110091212 13:71450359-71450381 TGTTACTATTGTAACTGTTTTGG + Intronic
1110132701 13:72026700-72026722 TGGTTTTATTTTCATTGTTTGGG - Intergenic
1110282416 13:73710595-73710617 TGTTTCTACTGTAATTGTTTTGG + Intronic
1110724117 13:78799870-78799892 TGTTACTATTGTAATTGTCTTGG - Intergenic
1110737609 13:78955919-78955941 TGTTACTACTGTAATTGTTTTGG - Intergenic
1110766477 13:79285042-79285064 TGTTACTATCGTAATTGTTTGGG + Intergenic
1110786353 13:79532078-79532100 TGTCACTATTGTAATTGTTTTGG - Intronic
1110841452 13:80148201-80148223 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1110962437 13:81645054-81645076 ATGTACTATTGTCACTGTTTTGG + Intergenic
1110995831 13:82108145-82108167 TGGCATTGTTGTGATTGTTTGGG - Intergenic
1111033616 13:82640282-82640304 TGTTACTATTGTAATTGTTCTGG - Intergenic
1111077860 13:83262793-83262815 TGTTACTACTGTAGTTGTTTTGG - Intergenic
1111135156 13:84032026-84032048 TGTTACTATTGTAATCATTTAGG - Intergenic
1111146327 13:84185624-84185646 TGTTACTATTGTAATTGTTTGGG - Intergenic
1111267532 13:85837217-85837239 TGCCACTCTTGTCATTGTGTGGG + Intergenic
1111274102 13:85925106-85925128 TGCTACTTTTGTAATTGTTTGGG - Intergenic
1111324243 13:86670835-86670857 TGTTGCTATTGTAATTGTTTAGG - Intergenic
1111360900 13:87174636-87174658 TGTAATTATTGTGATTGTTTTGG - Intergenic
1111384453 13:87505844-87505866 TGTTACTATTGTAATAGTTTTGG - Intergenic
1111463977 13:88583535-88583557 TGGCACGGTTGTCATTTTTTGGG - Intergenic
1111487122 13:88918399-88918421 TATTACTATTGTGATTGTTTTGG - Intergenic
1111571738 13:90096837-90096859 TGTTACTATTGTAATTATTTTGG - Intergenic
1111617644 13:90681415-90681437 GGATACTAATGTAATTGTTTGGG - Intergenic
1111839940 13:93437075-93437097 TGTTAATATTGTAATTGTCTTGG + Intronic
1111936644 13:94564489-94564511 TGTTACTAGTATAATTGTTTGGG - Intergenic
1111956796 13:94767833-94767855 TGTTACTATTGTGATTGTTTTGG - Intergenic
1112116226 13:96357858-96357880 TGTTACTATTGTAATTGTTTTGG - Intronic
1112208831 13:97352540-97352562 ATGTACTATTTTAATTGTTTTGG - Intronic
1112336310 13:98519983-98520005 TGGTTAGATTGTTATTGTTTTGG - Intronic
1112543859 13:100344936-100344958 TGTTCCCATTGTAATTGTTTTGG + Intronic
1112556249 13:100471290-100471312 TGTTACCATTGAAATTGTTTTGG - Intronic
1112653440 13:101423123-101423145 TGTTACTATTGTAATTGTTTCGG - Intergenic
1112728792 13:102335878-102335900 TGTTACTATTGTAATTGTTTTGG + Intronic
1112856708 13:103779682-103779704 TGATCCTATTGTAATTGTTTTGG - Intergenic
1113079991 13:106509085-106509107 TTTTAGTATTGTCATTGTTCTGG - Intronic
1113304449 13:109061636-109061658 TGTGACTATTATAATTGTTTTGG - Intronic
1113722724 13:112572718-112572740 TGCTGCTGTTGTAATTGTTTTGG - Intronic
1113991917 14:16034653-16034675 TGGTGCTGTCGTCATTGTTTTGG + Intergenic
1114223774 14:20720251-20720273 TGTTACTATTGTAATTATTTTGG - Intergenic
1114601983 14:23964036-23964058 TGGTTTTATTATAATTGTTTTGG - Intronic
1114606154 14:23999160-23999182 TGGTTTTATTATAATTGTTTTGG - Intronic
1114890864 14:26921263-26921285 TGTTACTATTGTAATTGTTTTGG + Intergenic
1114950050 14:27739014-27739036 TCTTACTATTGTAATTCTTTGGG + Intergenic
1115060620 14:29184889-29184911 TGTTACTATTGTAATTGTTTGGG - Intergenic
1115249694 14:31332229-31332251 TGTTACTATTTTAATAGTTTTGG + Intronic
1115258680 14:31430504-31430526 TGTTACTATCGTAATTGTTTTGG + Intronic
1115280516 14:31656687-31656709 TGTTACTACTGTAATTGTTGTGG - Intronic
1115293570 14:31800393-31800415 TGTTACTATTATAATTGTTGTGG - Intronic
1115340253 14:32286251-32286273 GTGTACTACTGTGATTGTTTTGG + Intergenic
1115627939 14:35213779-35213801 TGTTACTACTGTAATTGTTTTGG - Intronic
1115740786 14:36385686-36385708 TGTTACTATTGTAGTTGTTTTGG + Intergenic
1115898147 14:38113885-38113907 TGTTACTATTGTACTTGTTTTGG - Intergenic
1116016598 14:39415086-39415108 TGTTACTATTGTAATCATTTTGG - Intronic
1116101261 14:40439859-40439881 TATTACTATTATAATTGTTTTGG - Intergenic
1116141671 14:41003892-41003914 TGTTACTATTGTAATTGTTTGGG + Intergenic
1116150645 14:41137323-41137345 TGCCACTATTGTAATTGCTTTGG - Intergenic
1116210899 14:41942441-41942463 TAGAACTATTGTCATTTTTGAGG - Intergenic
1116305102 14:43243646-43243668 GGATACTATTTTCACTGTTTGGG - Intergenic
1116592363 14:46794505-46794527 TGTTATTATTGTAATTGTCTTGG - Intergenic
1116687997 14:48067127-48067149 TGTGAATATTGTCATTGTTTTGG - Intergenic
1116927432 14:50654494-50654516 TGTTACTATTGTAATTGTTTTGG - Intronic
1117074258 14:52085819-52085841 TGTTACTACTGTAATTGTTTTGG - Intergenic
1117201674 14:53396122-53396144 TGTTACCATTGTAATTATTTTGG + Intergenic
1117263436 14:54060825-54060847 TGTTACTGTTGTAATTGTTCTGG - Intergenic
1117401464 14:55362301-55362323 TGTTACTATTGTAATTGTTTTGG - Intergenic
1117519528 14:56536987-56537009 TGTTACTATTGTAATTGTCTGGG + Intronic
1117586932 14:57217494-57217516 TGTTACTATTTTAATTGTTTTGG + Intronic
1117887010 14:60374963-60374985 TGTTACTATTGTAATTGTTTTGG + Intergenic
1117935397 14:60899943-60899965 TGTTACTATTATTATTGTTTTGG + Intronic
1118037944 14:61888574-61888596 TGTTAATATTGTAATTGTTTTGG - Intergenic
1118116771 14:62786809-62786831 TGTTATTGTTGTAATTGTTTGGG + Intronic
1118124991 14:62891824-62891846 GGATATTATTGTGATTGTTTAGG + Intronic
1118260606 14:64243286-64243308 TGTTACTATTGTAATTGTTTTGG - Intronic
1118518058 14:66548478-66548500 GCCTACTATTGTAATTGTTTTGG + Intronic
1118549154 14:66930303-66930325 TGGAACTATTGTTAGTTTTTTGG + Intronic
1118693011 14:68358124-68358146 TGTTACTCTTGTAATTGTTTTGG - Intronic
1118927986 14:70211351-70211373 TGTTACTATTGTAATTATTTTGG - Intergenic
1119091576 14:71787019-71787041 TGTTACTATTGCAATTGTTTTGG + Intergenic
1119170552 14:72532263-72532285 TGTTACTATTGTAATTGCTCTGG + Intronic
1119308309 14:73625699-73625721 TGTTACTACTGTAATTGTTTTGG + Intergenic
1119944330 14:78675952-78675974 TGTTACTATTGTAATTGTTTTGG + Intronic
1120023812 14:79559515-79559537 GGTTACTATTGTAACTGTTTTGG - Intronic
1120174983 14:81283998-81284020 TGATACTATTGTAACTGTTTTGG + Intronic
1120280162 14:82429190-82429212 TGGGACTGTTGTCATTGTCAAGG - Intergenic
1120294915 14:82627768-82627790 TGATATTATTTTCATTCTTTAGG + Intergenic
1120544116 14:85789239-85789261 TATTCCTATTGTAATTGTTTTGG + Intergenic
1120755389 14:88239008-88239030 TGTCATGATTGTCATTGTTTTGG - Intronic
1121018754 14:90565930-90565952 TATTACTATTGTAATTGTTTGGG - Intronic
1121165567 14:91793622-91793644 TATTACTATTGTAATTGTTTTGG + Intronic
1121296239 14:92827392-92827414 TATAACTATTGTAATTGTTTTGG + Intronic
1121910372 14:97785251-97785273 TGTTACTATTGTAATTGTTTTGG + Intergenic
1122001367 14:98657992-98658014 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1122170382 14:99869330-99869352 TGTTAATACTGTAATTGTTTTGG + Intronic
1122173254 14:99895147-99895169 AACTACTATTGTCATTCTTTTGG - Intronic
1122734056 14:103825114-103825136 CGTTACTATTGTAATTGCTTTGG + Intronic
1123027061 14:105430421-105430443 TGCTACTATTGTAATTGTTTTGG - Intronic
1202838531 14_GL000009v2_random:98388-98410 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1202907894 14_GL000194v1_random:88456-88478 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1202885333 14_KI270722v1_random:100835-100857 TGCTACTGTTGTCATTGTTTTGG - Intergenic
1123708134 15:22965593-22965615 AGGCACTTTTGTCATTGTGTGGG - Intronic
1124397154 15:29312619-29312641 AGATACTATTATAATTGTTTTGG + Intronic
1124460999 15:29891689-29891711 TGTTACCACTGTAATTGTTTTGG + Intronic
1124901577 15:33828140-33828162 TGTTACTATTGTAATTGTTTTGG + Intronic
1124950325 15:34312902-34312924 TGTTACTATTGAAATTGTTTTGG + Intronic
1125000568 15:34765763-34765785 TGTTACTATTACAATTGTTTTGG - Intergenic
1125099602 15:35895780-35895802 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1125109255 15:36011809-36011831 TATTACTATTGTAATTGTTTTGG - Intergenic
1125135802 15:36341577-36341599 TATTATTATTGTTATTGTTTGGG - Intergenic
1125236766 15:37523783-37523805 TGTTACTGTTGGCATTGTTTAGG - Intergenic
1125252783 15:37724981-37725003 TGTTACTATTTTAATTGTTTTGG - Intergenic
1125624119 15:41092260-41092282 TGCTGTTTTTGTCATTGTTTTGG - Intronic
1125810479 15:42536117-42536139 TGGTACTATTTTAACTGTTTTGG - Intronic
1125822761 15:42647045-42647067 TGTTACTATTATAATTGTGTTGG - Intronic
1125870621 15:43098255-43098277 TGTTACTATTGTAATTGTTTTGG - Intronic
1125875335 15:43139202-43139224 TGTTACTATTGTAATTGTTTTGG + Intronic
1126151431 15:45526711-45526733 TATTACTATTGTAATTATTTGGG - Intergenic
1126240350 15:46434955-46434977 TGTTACCATTGCAATTGTTTTGG + Intergenic
1126307368 15:47275552-47275574 TGTTACTATTGTAATTGCTTTGG + Intronic
1126971613 15:54119388-54119410 TATTACTATTGTAATTGTTTTGG + Intronic
1127206228 15:56722185-56722207 TGTTACTATTGTAATTGTTTTGG - Intronic
1127370644 15:58335864-58335886 TGTTACTATCATAATTGTTTTGG + Intronic
1127575675 15:60289345-60289367 TTGTACTATTATTATTATTTTGG - Intergenic
1127705260 15:61540540-61540562 TGTTACTATTGTAATTGTTTTGG - Intergenic
1127757416 15:62106084-62106106 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1127948571 15:63781473-63781495 TGTTATTATTGTAATTGTTTGGG + Intronic
1128629362 15:69247884-69247906 TGTTGCTATTTTAATTGTTTTGG - Intronic
1128685712 15:69683832-69683854 TGTCACTATTGTAATTATTTTGG - Intergenic
1128690173 15:69718486-69718508 TACTACTATTGTAATTATTTTGG - Intergenic
1128722565 15:69961482-69961504 TGTTACTATTGCAATTGATTTGG + Intergenic
1128848946 15:70931356-70931378 TATTACTATTGCAATTGTTTTGG - Intronic
1129049164 15:72763899-72763921 TGCTACTATTATAACTGTTTTGG + Intronic
1129126447 15:73445790-73445812 TGTTACTATTGTAATTGTTCTGG - Intronic
1129289824 15:74556372-74556394 TGTTACCATTGTAATTGCTTTGG - Intronic
1129499287 15:76020079-76020101 TGTTACTATTGTAATTGTTTTGG + Intronic
1129575462 15:76738745-76738767 AGTTACTATTGTAATTGTTTTGG - Intronic
1130290445 15:82594969-82594991 TGCTGCTATTGTAATTGTTTTGG - Intronic
1130301775 15:82685138-82685160 TGTTACTATTGTAATTGTTTTGG - Intronic
1130408161 15:83621520-83621542 TGTTACTATTTTAACTGTTTTGG - Intergenic
1130410535 15:83644482-83644504 TGTTGATATTGTCACTGTTTAGG + Intergenic
1130764188 15:86853266-86853288 TGAAACTATTTTGATTGTTTTGG - Intronic
1131219042 15:90565724-90565746 TATTACTGTTGTAATTGTTTTGG + Intronic
1131756581 15:95570165-95570187 TGGCACTATTGTAATTACTTGGG - Intergenic
1131909958 15:97187417-97187439 TGTTACTATTGTACTTGCTTTGG - Intergenic
1132032417 15:98449650-98449672 CGTTACTATTGTAATTGTTTTGG - Intronic
1132475417 16:134001-134023 TGTTACTATTGTGATTGTTTTGG - Intronic
1133445463 16:5857276-5857298 TACTGCTATTGTAATTGTTTTGG - Intergenic
1133512996 16:6478831-6478853 TGGTACTATTATAATTGTTTTGG - Intronic
1133645111 16:7756693-7756715 TTGAACTATTCTCCTTGTTTGGG - Intergenic
1134349746 16:13425571-13425593 GGGTACTATGTTCATTGTTTGGG + Intergenic
1134753458 16:16645889-16645911 GTGTACTATATTCATTGTTTGGG - Intergenic
1134992600 16:18713189-18713211 GTGTACTATATTCATTGTTTGGG + Intergenic
1135656971 16:24258569-24258591 TCCAACTTTTGTCATTGTTTAGG - Intronic
1135819489 16:25669867-25669889 TGTTACTACTGTAATTTTTTGGG + Intergenic
1135832086 16:25784096-25784118 TGTTACCATTGTAATTATTTTGG + Intronic
1136025583 16:27466361-27466383 CCTTACTATTGTAATTGTTTTGG + Intronic
1136118981 16:28116746-28116768 TGTTACTATTGTAATTATTTTGG - Intronic
1136501541 16:30672493-30672515 TGTTACTATTGTAATTGCTTTGG - Intergenic
1136594420 16:31238029-31238051 AGTTACTATTGTAATTGTTTTGG - Intergenic
1136911237 16:34146257-34146279 TGGTGCTGTCGTCGTTGTTTTGG + Intergenic
1137022570 16:35443170-35443192 TGTAACTATTGTAACTGTTTGGG + Intergenic
1137234139 16:46599500-46599522 TGTTACTACTGTAATTGTTTTGG - Intronic
1137416155 16:48282593-48282615 TATTGCTATTGTGATTGTTTTGG + Intronic
1137746500 16:50824327-50824349 GGGTACTATGTTCACTGTTTGGG + Intergenic
1137900921 16:52268073-52268095 TGTTACTATTATAATTGTTTTGG + Intergenic
1138073005 16:54011793-54011815 TATTACTATTGTAATTGTTTTGG + Intronic
1138255484 16:55554987-55555009 TGCTACTATTATAATTGTTTTGG - Intronic
1138518376 16:57553054-57553076 TGTTACTATTGTAATTGTTTTGG - Intronic
1138966686 16:62093240-62093262 TGGTACAATGGTCACTATTTGGG - Intergenic
1139002922 16:62536070-62536092 TGTTACTATTGTACTAGTTTTGG - Intergenic
1139008038 16:62597460-62597482 TGGCAGTAATGTCATTGTTTGGG + Intergenic
1139094995 16:63694658-63694680 GGGTACGATGGTCATTATTTTGG + Intergenic
1140157083 16:72441756-72441778 TGTTACTATTGTAATTGTTTTGG - Intergenic
1140493168 16:75358088-75358110 TGATACTATTGTAATTGTTTTGG - Intronic
1141292325 16:82730517-82730539 TGTTACTATTGTAACTGTTTTGG - Intronic
1141349639 16:83282195-83282217 TGTTACTATTGTATCTGTTTTGG - Intronic
1142616267 17:1137558-1137580 TGTTAGCATTGTCATTGTTTTGG - Intronic
1142653493 17:1373307-1373329 CGTTACTATTGTAATTGTTTTGG - Intronic
1142922731 17:3205186-3205208 TCTTACTATTGTAATTGTTTTGG + Intergenic
1144116568 17:12098995-12099017 GGGTACAATTTACATTGTTTGGG - Intronic
1144302748 17:13937877-13937899 TGGTATTATTTTCTTTCTTTTGG - Intergenic
1144324458 17:14165420-14165442 TGTTACTGTTGTAATTGTTTTGG + Intronic
1144530809 17:16037227-16037249 TATTACTATTGTAATTGTTTGGG - Intronic
1144706812 17:17373946-17373968 TCTTACTATTGTAATTGTTTGGG + Intergenic
1145717583 17:27036781-27036803 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1146042988 17:29474651-29474673 CATTACTATTGTAATTGTTTTGG - Intronic
1146538732 17:33676089-33676111 TGTTACTATTGTAGTTGTTTTGG + Intronic
1146578743 17:34017245-34017267 TGTTACTGATGTAATTGTTTGGG + Intronic
1146838176 17:36129053-36129075 TGTTATTATTGTAATTGTTTTGG + Intergenic
1147027948 17:37604964-37604986 TGTTACTAGTGTAATTGTTTTGG - Intronic
1147049359 17:37779948-37779970 GTTAACTATTGTCATTGTTTTGG + Intergenic
1147371990 17:39998743-39998765 TGTTACTATTGTCATTGTTGGGG + Intergenic
1148660287 17:49325407-49325429 TGTTACTGTTATAATTGTTTTGG - Intronic
1148803840 17:50253450-50253472 TGTTACTATTGCAATTGTTTTGG - Intergenic
1149033128 17:52105606-52105628 TGTTATTATTGTCATTTTGTAGG - Intronic
1149192082 17:54075055-54075077 TGTTACTACTGTAATTGTTTTGG + Intergenic
1149299401 17:55290484-55290506 TGTTACTATTGTTATTGTTTGGG + Intronic
1149378115 17:56065748-56065770 TGTTTCTATTCTTATTGTTTTGG - Intergenic
1149390198 17:56181985-56182007 TGTTACCATTGTCATTGTTTTGG + Intronic
1149411794 17:56416091-56416113 TTGTACTAATTTCATAGTTTAGG - Intronic
1149940929 17:60865000-60865022 CGTTATTATTGTAATTGTTTTGG - Intronic
1149972046 17:61228628-61228650 CGTTACTATTGTAATCGTTTGGG + Intronic
1150014261 17:61537941-61537963 TGTTACTATTGTAATTGTTTTGG + Intergenic
1150031610 17:61742710-61742732 TGTTACTATTGTAATTGTTTTGG - Intronic
1150090020 17:62315516-62315538 TGTTACTACTGTAATTGTTATGG + Intergenic
1150468154 17:65412909-65412931 TGTTTCTATCGTAATTGTTTTGG - Intergenic
1150509365 17:65733286-65733308 TGTTACTATTGTCATTGTTTTGG - Intronic
1150866666 17:68857807-68857829 TGTTACTATTGCAATTGTTTTGG + Intergenic
1150947969 17:69767745-69767767 TGTTATTATTGTAATTCTTTTGG + Intergenic
1151377691 17:73702439-73702461 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1151792973 17:76321213-76321235 TGTTACTATTCCAATTGTTTTGG + Intronic
1151859041 17:76745580-76745602 TGTTACTATTGCAATTGTTTTGG + Intronic
1152194268 17:78907515-78907537 CGTTACTGTTGTAATTGTTTTGG - Intronic
1152971876 18:169842-169864 TGTTACTTTTGTAATTGTTTTGG + Intronic
1153126453 18:1798087-1798109 TGTTACTATTGTAGATGTTTTGG + Intergenic
1153181537 18:2440765-2440787 TGTTACTATTATAATTGTTTTGG - Intergenic
1153270653 18:3317984-3318006 TGTTACTATTGCAATTTTTTTGG - Intergenic
1153287884 18:3473112-3473134 TGTTACTATTGTAATTGTTTGGG + Intergenic
1153292811 18:3518328-3518350 TGTTACTATTGTAATTGTTTTGG - Intronic
1153566431 18:6422838-6422860 TGTTACAATTGTAATTGTTTTGG - Intergenic
1153569883 18:6459595-6459617 TGTTACTATTGTAATTGTTTTGG + Intergenic
1153696492 18:7648169-7648191 TGTTACTATTGTAATTGTTTTGG + Intronic
1153739072 18:8104024-8104046 TGTTACTCTTGTAATTGTTTTGG - Intronic
1153803675 18:8693711-8693733 TATTACTATTGTCATTGTTTTGG + Intergenic
1153896321 18:9565199-9565221 TATTACTATTGTAATTGTTTTGG + Intronic
1154220126 18:12445291-12445313 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1154227632 18:12521819-12521841 TGTTACTATTGTCATTGCTTTGG + Intronic
1154341639 18:13507654-13507676 TGTTACTATTGTAGTTGTTTTGG + Intronic
1154352497 18:13597329-13597351 TGTTACTATTTTCCTTGGTTTGG + Intronic
1154470998 18:14701359-14701381 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1154953221 18:21230102-21230124 TGTAACTATTGTAATTGTTTTGG - Intergenic
1155101581 18:22615727-22615749 TGTTACTATTGTAATTGTTTTGG + Intergenic
1155266177 18:24096048-24096070 TGTTACTATTTTAATTGTTTTGG - Intronic
1155626372 18:27839616-27839638 TGCTACTCTTGTAATTGTTTTGG + Intergenic
1155681108 18:28488019-28488041 TGTTACTATTGTAATTGTTTTGG + Intergenic
1155694317 18:28666579-28666601 TGTTATTATTGCAATTGTTTTGG - Intergenic
1155809960 18:30219847-30219869 TGTTACTATTGCAATTGTTTTGG - Intergenic
1155824624 18:30424169-30424191 TGTTACTATTGTAATGGTTTTGG + Intergenic
1156085857 18:33401123-33401145 TGTTACTATTGTAATTGTTTTGG - Intronic
1156102583 18:33615400-33615422 TGTTACTACTGTAATTGTTTGGG - Intronic
1156287995 18:35718112-35718134 TGATACTATTGTAATTGTTTGGG + Intergenic
1156572253 18:38269794-38269816 TGTTACCATTGTAAGTGTTTTGG - Intergenic
1156579794 18:38361779-38361801 TGTTACTGTTGTTATTATTTGGG - Intergenic
1156711618 18:39953715-39953737 TGTTACTATTTTAATTGTTCGGG - Intergenic
1156722197 18:40083934-40083956 ATGTCCTATTGTCACTGTTTTGG - Intergenic
1156785633 18:40910524-40910546 TGTTACTACTGTCATTGTTTTGG - Intergenic
1157010245 18:43639511-43639533 GGTTACTATTGTTATTGTTTTGG - Intergenic
1157217119 18:45793575-45793597 TGTTAATCGTGTCATTGTTTTGG + Intergenic
1157371855 18:47120922-47120944 TGTTACTGTTGTAATTGTTTTGG - Intronic
1158006448 18:52677508-52677530 TGTTTCTATTGTTATTATTTTGG + Intronic
1158204623 18:54978915-54978937 TGTTACTATTACAATTGTTTTGG - Intergenic
1158836806 18:61339436-61339458 GGGTACAATGGTCATTATTTGGG - Intronic
1158978131 18:62731383-62731405 TGTTACTATTGTAATTGTTTTGG + Intronic
1159121214 18:64173671-64173693 TTTTACTATTATAATTGTTTTGG - Intergenic
1159175636 18:64829946-64829968 TGTTACTATTATAATTGTTCTGG - Intergenic
1159198842 18:65156725-65156747 TGTTAGTATTTTCATTGTTTTGG + Intergenic
1159282187 18:66300307-66300329 TGTTCCTATTGCAATTGTTTGGG - Intergenic
1159671064 18:71221593-71221615 TGTTACTATTGTCACTGATAGGG - Intergenic
1159700538 18:71621189-71621211 TGTTATTATTCTAATTGTTTAGG - Intergenic
1159740664 18:72165953-72165975 TGTTACTATTGTAATTATTTTGG + Intergenic
1159906278 18:74095587-74095609 TGTTACTATTGTAACTGTTTTGG - Intronic
1160117411 18:76093688-76093710 TGTTGTTATTGTAATTGTTTTGG - Intergenic
1160320578 18:77889836-77889858 TCTTACTATTGAAATTGTTTTGG - Intergenic
1160347899 18:78149964-78149986 TGTTACTATTGCAATTATTTGGG - Intergenic
1160520307 18:79504497-79504519 GGTTACTGTTGTCATTGTTTTGG - Intronic
1160546499 18:79660317-79660339 TGTTACTACTGCAATTGTTTTGG - Intergenic
1160552048 18:79699997-79700019 GGTCACTGTTGTCATTGTTTTGG + Intronic
1162264740 19:9562480-9562502 TGTTCCTATTTTAATTGTTTTGG + Intronic
1162843742 19:13375206-13375228 TGTGACTATAGTCATTGTTTGGG + Intronic
1164591258 19:29508599-29508621 AGGTACTATGTTCACTGTTTGGG + Intergenic
1165644435 19:37422403-37422425 TGTTACTGTTGTCATTGTTTTGG - Intronic
1165840906 19:38788759-38788781 TGGCACTATCGTCGTTGTTGTGG + Intergenic
1166021371 19:40033112-40033134 TGTTACTAGTGTAATTGTTTGGG - Exonic
1166024882 19:40073293-40073315 TGTTGCTATTGTAATTGCTTTGG - Exonic
1166580185 19:43890295-43890317 TGTTACTGTTGTAATTGCTTTGG - Intronic
1167626822 19:50595806-50595828 TGTTGCTATTGTAATTGTTTTGG + Intergenic
1168550167 19:57286325-57286347 TGTTACTATTGTAATTGCTATGG + Intronic
1168586278 19:57595995-57596017 TGGATCTATGGTAATTGTTTTGG - Intergenic
1168652820 19:58103507-58103529 TGTAACTATTGTAATTGTTCTGG + Intronic
1202651387 1_KI270707v1_random:7852-7874 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1202660738 1_KI270708v1_random:67864-67886 TGCTACTGTTGTCATTGTTTTGG - Intergenic
924989603 2:301228-301250 TGTTACTATTGTAACTGTTTTGG + Intergenic
925168598 2:1736497-1736519 TGTTACTATTGTAATTGTTTTGG - Intronic
925176443 2:1787632-1787654 TGGTACATTTGTAATTGTTTTGG + Intergenic
925200482 2:1964264-1964286 TGGTACCACTGTGATTGTTTGGG - Intronic
925360088 2:3272630-3272652 TGTTCCTATTGTAATTGTTTTGG - Intronic
925556661 2:5138294-5138316 TGGAACTATTGTAATTATTGTGG + Intergenic
925606141 2:5662126-5662148 TGTTATTATTGTTATTGTTTTGG - Intergenic
925679524 2:6404255-6404277 TATTACTATTATAATTGTTTTGG - Intergenic
926031923 2:9598645-9598667 CGTTACTACTGTAATTGTTTTGG + Intronic
926057464 2:9782737-9782759 TGTTACTACTGTAATTGTTTTGG + Intergenic
926189429 2:10717114-10717136 TGTTATCATTGTCACTGTTTTGG - Intergenic
926469798 2:13239622-13239644 TGTTAGTATTGTAATTGTTTAGG - Intergenic
926537872 2:14135800-14135822 TGTTACTATTGTAATTCTTTTGG + Intergenic
926608441 2:14921290-14921312 TGTTACTATTATAATTGTTTTGG - Intergenic
926649461 2:15326092-15326114 TGTTACTATTGCAGTTGTTTTGG - Intronic
926818588 2:16827145-16827167 CACTACTATTGTAATTGTTTTGG - Intergenic
927014392 2:18942563-18942585 TGTTACTGTTATAATTGTTTTGG - Intergenic
927322552 2:21764311-21764333 TGTTACTATTATAATTGTTTTGG - Intergenic
927335722 2:21921867-21921889 TGGTACTATTTCCATTGTTTGGG - Intergenic
927657300 2:24960230-24960252 TGTTACTATTTTAAGTGTTTTGG + Intronic
927731322 2:25474886-25474908 TGTTACTATTGTAATTGTTTTGG + Intronic
928227165 2:29460603-29460625 TGTTAGTATTGTAATTGGTTTGG + Intronic
928341212 2:30444717-30444739 TTGTACTTTTGTCATTATTGGGG - Intergenic
928586707 2:32766590-32766612 TGCTACTATTGCAATTGTTTGGG - Intronic
928607570 2:32957562-32957584 TGTTACCATTGTAATTGTTTTGG - Intronic
928631159 2:33193738-33193760 TGTTACTATTGTAATTGTTTTGG + Intronic
928657223 2:33464790-33464812 TGTTACTATTGTAAGTGTTTTGG + Intronic
928720061 2:34110192-34110214 TGTTACTATTGTATTTGTTTTGG + Intergenic
929375121 2:41276351-41276373 TGTTACTAACGTAATTGTTTTGG - Intergenic
929473465 2:42220429-42220451 TGTTACTGTTGTAATTGTTTTGG + Intronic
929529773 2:42741762-42741784 TGTTACTATTGTAATTGTTTTGG - Intronic
929749977 2:44700667-44700689 TGTTACTATGGTAATTGTTTTGG - Intronic
929866787 2:45724263-45724285 TGTTACTATTATAACTGTTTTGG + Intronic
930127936 2:47817826-47817848 TGTTACTATTGTAATTGTTTTGG - Intronic
930471684 2:51823883-51823905 TGGTACTTTTGTAATTGTTCAGG + Intergenic
930583133 2:53236545-53236567 TGTTACTATTGTAATTGTTTTGG + Intergenic
930631011 2:53755272-53755294 TGGTTCCATTGGCAGTGTTTGGG - Intronic
930800302 2:55436959-55436981 TGTTACTATTTTAATTGTTTTGG - Intergenic
931050690 2:58411141-58411163 TGTTCCTATTGTAATTGTTTTGG + Intergenic
931141933 2:59468963-59468985 TGTTACCATTATAATTGTTTGGG - Intergenic
931279620 2:60777882-60777904 TGTTACTATTGTAATTGTTTTGG - Intronic
931877444 2:66529078-66529100 TAGTACAATTGTCACTGCTTGGG + Intronic
931924858 2:67060998-67061020 CGTTACTATTGTAATTGCTTTGG - Intergenic
931960952 2:67482337-67482359 TGTTACTATTTTAATTGTTTTGG + Intergenic
932033361 2:68213500-68213522 TGTTACTATTGTAATCATTTTGG - Intronic
932052557 2:68413412-68413434 GGTTACTATTGTTATTGTTTTGG + Intergenic
932186111 2:69697805-69697827 TGTTACCATTGTTAATGTTTAGG - Intronic
932286450 2:70537146-70537168 TGTTACTATTGTAATTGTTTCGG + Intronic
932469961 2:71948348-71948370 TGTTACTATTGTATTTTTTTGGG - Intergenic
932857401 2:75250715-75250737 TACTACTATTGTAATTGTTCTGG - Intergenic
932862417 2:75308006-75308028 TATTACTATTGTATTTGTTTTGG + Intergenic
932997759 2:76878166-76878188 TGTTACTGTCGTAATTGTTTTGG + Intronic
933082913 2:78015813-78015835 TGTTACTATTGTAATGGTTTGGG - Intergenic
933150531 2:78909650-78909672 AAGGACTATTGTCATTATTTTGG - Intergenic
933182052 2:79238349-79238371 TGTTACCAATGTAATTGTTTTGG - Intronic
933302047 2:80552136-80552158 TGTCACTATTGCAATTGTTTTGG - Intronic
933306641 2:80608591-80608613 TGTGACTATTGTAATTATTTGGG + Intronic
933324108 2:80814465-80814487 TGGGACTATTGTTCTTGTTTGGG + Intergenic
933387040 2:81624100-81624122 TCTTACTATTATAATTGTTTGGG - Intergenic
933414204 2:81965178-81965200 TGTTACTATTGTAATTGTTTTGG + Intergenic
933548932 2:83749539-83749561 TGTTACTATTGCGATTGTTTTGG + Intergenic
933575938 2:84067772-84067794 TGTTACTATTGCAATTGTGTTGG + Intergenic
933873588 2:86595336-86595358 TGTTACTATCGTAACTGTTTTGG + Intronic
933944562 2:87274513-87274535 TGTTACTATTATAACTGTTTGGG - Intergenic
934127322 2:88909292-88909314 TGTTACTATTATAATTGCTTTGG + Intergenic
934715939 2:96543548-96543570 TGTTCCTATTGTCATTGTTTTGG + Intronic
935081233 2:99796964-99796986 TGGAAATAGTGTGATTGTTTTGG - Intronic
935168916 2:100594719-100594741 TGTTACTGTTGCAATTGTTTGGG - Intergenic
935228366 2:101074308-101074330 TGTTACTGTTGTAATTGTTTTGG - Intronic
935295334 2:101644357-101644379 TGTTACTATTATAATTGTTTTGG - Intergenic
935548674 2:104428421-104428443 TGGCACTATTTTCTTTATTTAGG + Intergenic
935608230 2:104992312-104992334 TGTTACTATTGCAATTGTTTTGG + Intergenic
936257070 2:110926105-110926127 TGTTACTATTGTAATCGTTTTGG - Intronic
936335651 2:111587068-111587090 TGTTACTATTATAACTGTTTGGG + Intergenic
936365919 2:111855244-111855266 TGTTACTATTGGAATTCTTTTGG - Intronic
936828058 2:116605242-116605264 TGTTACTATTGTAATTATTTTGG - Intergenic
936920167 2:117680440-117680462 TGTTACTGTTGTAATTATTTTGG + Intergenic
937461777 2:122095110-122095132 TGTTACTGTTGTAATTGTTTTGG - Intergenic
937678359 2:124616924-124616946 TGTTATTATTCTAATTGTTTTGG - Intronic
937722493 2:125119445-125119467 TGATATTATTGTAATAGTTTTGG + Intergenic
937796669 2:126030648-126030670 TGTCACTATTGTAATTATTTTGG - Intergenic
937979288 2:127604852-127604874 TGTTACAATTGGAATTGTTTTGG - Intronic
938022557 2:127917960-127917982 TGTTACTATTGTAATTGTTTTGG - Intergenic
938158618 2:128962520-128962542 TGTTACTACTGTAATTGTTTGGG + Intergenic
938174192 2:129109275-129109297 TGTTACTGCTGTCATTGTTTTGG - Intergenic
938562557 2:132487184-132487206 TGTTACTATTGTAATTGTTTTGG - Intronic
938621304 2:133057072-133057094 TGTGACTATTGTCATTATTTTGG + Intronic
938942971 2:136185514-136185536 GGGTACTATGGTCATTATCTGGG + Intergenic
938960615 2:136337295-136337317 TGTTACTGTTGTAATTGTTTTGG + Intergenic
938987238 2:136589317-136589339 TGTTACTGTTGTAATTGTTTTGG - Intergenic
939035576 2:137127005-137127027 TGTTATTATTGTCATTGTTTTGG - Intronic
939207557 2:139127203-139127225 TGTTACTATTGTAATTGTTTTGG + Intergenic
939274314 2:139980498-139980520 TGTTATTATTGTAATTGTTTTGG - Intergenic
939285465 2:140123413-140123435 TGTTGTTATTGTAATTGTTTGGG - Intergenic
939308966 2:140447996-140448018 TAATACTATTGTAATTGTTTTGG - Intronic
939437328 2:142195230-142195252 AGGTACTATGTTCATTATTTGGG + Intergenic
939437808 2:142201170-142201192 TGTTACTATTGTAATTGTTCTGG + Intergenic
939494751 2:142914707-142914729 TGTTATTATTGTCATTATCTTGG + Intronic
939502477 2:143004908-143004930 TAGTATTATTTTCATTGGTTGGG + Intronic
939509136 2:143085074-143085096 TGTTACTATTATAATTGTCTTGG + Intergenic
939556196 2:143676683-143676705 TGTTACTGTTGTAATTGTTTTGG - Intronic
939640189 2:144631371-144631393 TGTTACTATTTTAATTGTTTTGG + Intergenic
939867780 2:147493611-147493633 TGTTACTATTGCAATTGTTTGGG + Intergenic
940024004 2:149185868-149185890 TGTTACTATTGTAATTGTTTGGG + Intronic
940037480 2:149325994-149326016 TGTTACTATTGTAATTGTTTTGG - Intergenic
940384663 2:153056951-153056973 TGTTACTCTTGTAATTGTTTTGG + Intergenic
940448058 2:153801585-153801607 TGTTACTATTGTAACTCTTTTGG - Intergenic
940608426 2:155958665-155958687 TGTTACTATCGTAATTGTTTTGG + Intergenic
940727542 2:157352065-157352087 TGTTACTATTGTAATTGTTTTGG + Intergenic
941020221 2:160399921-160399943 TGGTTCCAGTCTCATTGTTTTGG - Intronic
941056419 2:160794841-160794863 TATTACTATTGTAATTGTTATGG + Intergenic
941077463 2:161022145-161022167 TGTTAATATTATAATTGTTTTGG + Intergenic
941082968 2:161083653-161083675 TGTTGCTATTGTAAATGTTTGGG - Intergenic
941260061 2:163286293-163286315 TGTTAATATTGTCATTGTGTTGG - Intergenic
941312186 2:163947342-163947364 TGTTAATATTGAAATTGTTTTGG - Intergenic
941433875 2:165444303-165444325 AGTTACTATTGTAATTGTTTTGG + Intergenic
941503766 2:166314051-166314073 TGTTACTGTGGTAATTGTTTTGG - Intronic
941801876 2:169668772-169668794 TGTTACTATTGTAATGTTTTGGG - Intronic
941925190 2:170887260-170887282 GGGTACTATGGTCACTATTTGGG + Intergenic
942050742 2:172138416-172138438 TGTGACTATTGTAATTGGTTGGG + Intergenic
942077333 2:172367954-172367976 TGTTACTATGGTAATCGTTTGGG + Intergenic
942238147 2:173932638-173932660 TGTTACTGTTGTAATTGTCTTGG - Intronic
942614888 2:177781293-177781315 TGTTACTATTGTAATCCTTTGGG - Intronic
942747777 2:179254996-179255018 TGTTACTACTGTAATTGTTTGGG + Intronic
942822392 2:180129986-180130008 TGTTACTATTGTAATTGCCTTGG - Intergenic
942833194 2:180261560-180261582 TGTTACTTTTGTAATTGTTTTGG - Intergenic
942876848 2:180810813-180810835 TGTTACTATTTTAATTGTTTTGG + Intergenic
942999327 2:182304778-182304800 TGTTACTATTATAATTGTTTTGG - Intronic
943012681 2:182469960-182469982 TGTTACTATTGCAATTGTTGTGG - Intronic
943034479 2:182725133-182725155 TGTTACTATTGTAATCATTTTGG + Intronic
943083902 2:183289142-183289164 TGATACTATTGTCATTGTTTAGG + Intergenic
943087395 2:183329149-183329171 TATTACTATTGTAATTGTTTTGG + Intergenic
943213444 2:184999258-184999280 TGTTACTATTGGAATTGTCTTGG - Intergenic
943251712 2:185529890-185529912 TGTTCCTATTATAATTGTTTTGG - Intergenic
943285846 2:185998997-185999019 TGTTACTATTGTAGTTGTTTTGG + Intergenic
943305868 2:186261941-186261963 GGTCACTATTGTAATTGTTTGGG + Intergenic
943604886 2:189965263-189965285 GGTTACTTTTGTAATTGTTTTGG - Intronic
943616571 2:190099478-190099500 TGTTACTTTTGTATTTGTTTTGG - Intronic
943799609 2:192041889-192041911 TGTTACTACTGTAATTGTTTTGG - Intronic
943935443 2:193909539-193909561 TGTTACTATTGTAATTGTTTTGG + Intergenic
943952516 2:194148413-194148435 TGTTACTATTGCAGTTGTTTTGG - Intergenic
944025825 2:195166229-195166251 TGTTATTATTATAATTGTTTTGG + Intergenic
944043791 2:195385645-195385667 TGTTACCACTGTAATTGTTTTGG - Intergenic
944059117 2:195553473-195553495 TGTTACTATTGTAATTGTTTTGG - Intergenic
944232479 2:197410213-197410235 TGGGACTTTTGTCAGTGCTTCGG - Intronic
944255700 2:197621591-197621613 TGTTACTATTGTAATTGTTTTGG + Intronic
944273948 2:197814361-197814383 TGTTACTATTGTAATTGTTTTGG + Intronic
944529564 2:200653887-200653909 TTTTACTGTTGTAATTGTTTTGG + Intronic
944623031 2:201538602-201538624 TGTTACTATTGTAATTGTTGAGG + Intronic
944719986 2:202414231-202414253 TGTTACTATTGTAATTGTTTTGG + Intronic
945126171 2:206512940-206512962 TGTTACTATTATGGTTGTTTTGG + Intronic
945330384 2:208532843-208532865 TGTTACCATTGTAATTGTTTTGG + Intronic
945413627 2:209543286-209543308 CGTTACTGTTGTAATTGTTTTGG - Intronic
945442800 2:209900405-209900427 TGATATTATTGTCGTTGTTTTGG + Intronic
945541697 2:211095795-211095817 AATTACTATTGTAATTGTTTTGG + Intergenic
945643676 2:212462136-212462158 TTCTAGTAGTGTCATTGTTTTGG - Intronic
945830215 2:214775462-214775484 TGTAACTATTGTAATTGCTTTGG - Intronic
946063116 2:216962016-216962038 TGTTACTATCATAATTGTTTTGG + Intergenic
946264816 2:218530408-218530430 TGTTACTGTTGTCACTGTTTTGG + Intronic
946461136 2:219869914-219869936 TGGTATTTTTATTATTGTTTAGG - Intergenic
946524206 2:220500603-220500625 TGCTACTATTGTAATTGTTTTGG + Intergenic
946645469 2:221828706-221828728 TGTTCCTATTTTAATTGTTTTGG - Intergenic
946853212 2:223928071-223928093 TATTACTATTGTAATTGTTTTGG - Intronic
946901236 2:224373925-224373947 TGTTACTATTGTAATTATCTGGG + Intergenic
947020740 2:225672905-225672927 TGTCACTATTGTAATTGCTTGGG - Intergenic
947234600 2:227926916-227926938 TGTTACTATTATAATTGCTTTGG + Intergenic
947256303 2:228168514-228168536 TGTTACTATTGTGATTATTTTGG + Intronic
947554025 2:231073199-231073221 TGTTACCATTGTAGTTGTTTTGG - Intronic
947654667 2:231816616-231816638 TGTTACTATGGTAATTGCTTTGG - Intergenic
947754192 2:232550043-232550065 TGTTGCTATTGTCATTGTTTTGG - Exonic
948072269 2:235137531-235137553 TTTTATTATTGACATTGTTTAGG + Intergenic
948418381 2:237835124-237835146 TGTTACTATTGTAATTATTTTGG + Intronic
948506563 2:238431841-238431863 TGTTACTATTGTAATTGTTTTGG - Intronic
948955037 2:241282696-241282718 TGTTACTACTGTAATTGTTTTGG + Intronic
949065636 2:241988649-241988671 TTTTATTATTGTCATTATTTGGG + Intergenic
1168912061 20:1456165-1456187 TGGTACTGTTGTCCTTGTCGGGG - Intronic
1169090259 20:2856308-2856330 TGTTACTACTATAATTGTTTTGG - Intronic
1169174757 20:3501106-3501128 TGGTATTATTGGTATTGTTCTGG + Intronic
1169322203 20:4642479-4642501 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1169616245 20:7449279-7449301 TGTTACTATCGTAATTGTTTTGG + Intergenic
1169653876 20:7900554-7900576 TGTTACTATTGTAATTGTTTTGG + Intronic
1169696029 20:8387477-8387499 TATTACCATTGTAATTGTTTTGG - Intronic
1169744646 20:8931282-8931304 GGTTACTATTGTAATTCTTTTGG - Intronic
1169836714 20:9888389-9888411 TGTTGCTATTGTAATTTTTTGGG - Intergenic
1169908216 20:10624682-10624704 CTGTACTCTTGTCATTGTTTTGG - Exonic
1170237767 20:14126764-14126786 TGTTACCATTGTAACTGTTTTGG + Intronic
1170280600 20:14642745-14642767 TGTTACTATTGCAATTGTTTTGG - Intronic
1170316927 20:15052523-15052545 CATTACTATTGTCATTGTTTTGG + Intronic
1170397118 20:15938482-15938504 TGTTACTATTATAATTGTTTTGG + Intronic
1170502064 20:16984371-16984393 TGTTACTATTGTAATTGTTTTGG + Intergenic
1170642694 20:18169486-18169508 TGTTAGTATTGTAATTGTTTTGG + Intronic
1170682815 20:18541693-18541715 TGTTACCATTTTAATTGTTTTGG - Intronic
1170904579 20:20501988-20502010 TGTTGCTATCGTAATTGTTTTGG - Intronic
1170996709 20:21367708-21367730 AGTTGTTATTGTCATTGTTTTGG + Intronic
1171205487 20:23276065-23276087 TATTACTATTGTAATTGTTTTGG + Intergenic
1171251351 20:23651115-23651137 TGTTACTATTGTAATTGTTTTGG - Intergenic
1171769938 20:29314585-29314607 TGGTGCTGTTGTTGTTGTTTTGG - Intergenic
1171812663 20:29757778-29757800 TGGTGCTGTCGTCATTGTTTTGG - Intergenic
1171906582 20:30904526-30904548 TGGTGCTGTCGTCATTGTTTTGG + Intergenic
1172257766 20:33534841-33534863 TATTACTATTCTAATTGTTTTGG - Intronic
1172267386 20:33628191-33628213 TGGTTATATTGTCATTTTGTGGG + Intronic
1172471141 20:35197315-35197337 TGTTACTATTGTAATTGTTTTGG + Intergenic
1172661074 20:36569327-36569349 TGTTACTATTGTAATTGTTTTGG - Intergenic
1173107111 20:40147987-40148009 TGTTACTATTGTAACTGTTTGGG - Intergenic
1173766816 20:45618704-45618726 TGTTACTATTGTAATTGCTTTGG - Intronic
1173768218 20:45633092-45633114 TATTACTGTTGTAATTGTTTTGG + Intergenic
1173882518 20:46427090-46427112 TGTTACTATTTTAATTGTTTTGG + Intronic
1174692547 20:52522000-52522022 TGTTACTATTGTAATTGTTTTGG - Intergenic
1174745956 20:53063032-53063054 TGTTACTGTTGTAATTGTTTCGG - Intronic
1175025597 20:55899111-55899133 TGTCACTACTGTAATTGTTTTGG - Intergenic
1175088389 20:56480858-56480880 TGTTACTTTTGTAATTGTTTTGG - Intronic
1176600755 21:8791793-8791815 TGCTACTGTTGTCATTGTTTTGG - Intergenic
1176627254 21:9103143-9103165 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1176646714 21:9357962-9357984 TGCTACTGTTGTCATTGTTTTGG - Intergenic
1176702525 21:10072704-10072726 TGTTACTATTGTAATTGTTTTGG - Intergenic
1176735837 21:10546241-10546263 TGTTACTATTGTAATTGTTTTGG + Intronic
1176803485 21:13456575-13456597 TGTTACTGCTGTAATTGTTTTGG - Intergenic
1176946038 21:14982896-14982918 TGTTACTATTATAATTGTTTTGG + Intronic
1177044027 21:16146904-16146926 TATTACTATTGGAATTGTTTTGG + Intergenic
1177046313 21:16173961-16173983 CGTTACTATTGTAATTGTTTGGG - Intergenic
1177162528 21:17563510-17563532 TGTTACTATTTTAACTGTTTTGG - Intronic
1177298477 21:19208253-19208275 TGTTACTATTATAATTGTTTGGG - Intergenic
1177391327 21:20476788-20476810 AGTTACTATTGTAATCGTTTTGG + Intergenic
1177461461 21:21416302-21416324 TGGTACTATTGTAACTGTTTTGG - Intronic
1177646505 21:23905338-23905360 TGTTACTATTCTAATTATTTGGG - Intergenic
1177699671 21:24621853-24621875 TGCTACAATTGTAATTGCTTTGG + Intergenic
1177807915 21:25893129-25893151 TGTTACTATTTTAATTGTTTTGG + Intronic
1177853878 21:26379896-26379918 AGTTATTATTGTAATTGTTTGGG - Intergenic
1178100549 21:29264156-29264178 TGTTCCTATTGTAATTGTTTGGG - Intronic
1178278901 21:31264224-31264246 GGGTACTGTGTTCATTGTTTGGG - Intronic
1178519446 21:33275898-33275920 TGTTACTGTTGTAATTGTTTTGG - Intronic
1178967516 21:37136033-37136055 TGTTACTATTGTAATTATTTTGG + Intronic
1179202778 21:39241895-39241917 TGTTACTATTCTAATTGTTTTGG + Intronic
1179220385 21:39401836-39401858 TGTTACTACTGTAATTGTTTTGG + Intronic
1179386962 21:40952690-40952712 TGTTACTCCTGTAATTGTTTTGG + Intergenic
1179395524 21:41036586-41036608 TGTTACTATTGTCATTGTTTTGG - Intergenic
1179429194 21:41307790-41307812 TGTTACTATTGTGACTATTTTGG - Intronic
1179965157 21:44800050-44800072 TGTTACTATTGTAATTATTTTGG - Intronic
1180315355 22:11272873-11272895 TGGTGCTGTCGTCATTGTTTTGG - Intergenic
1180328224 22:11451457-11451479 TGCTACTGTTGTCATTGATTTGG - Intergenic
1180339994 22:11610618-11610640 TGGTGCTGTCGTCATTGTTTTGG + Intergenic
1180343041 22:11683330-11683352 TGCTACTGTTGTCATTGTTTTGG - Intergenic
1180366212 22:11941042-11941064 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1180417601 22:12782752-12782774 TGCTACTGTTTTCATTGTTTTGG + Intergenic
1180848873 22:19000873-19000895 TGCTACTATAGTAATTGTTTTGG - Intergenic
1180878982 22:19190417-19190439 TGTTACTATTGTAATTGTTTTGG - Intronic
1180932593 22:19603320-19603342 TGTTACTATTGTCATTGTTTTGG - Intergenic
1181552025 22:23645316-23645338 GGGTACTATGGTCAGTGTTTGGG - Intergenic
1181664067 22:24378785-24378807 TGTTACTATAGTAATTGTTTTGG - Intronic
1181930639 22:26398426-26398448 TGTTACTACTGTAACTGTTTTGG - Intergenic
1182182113 22:28360931-28360953 TGTTACTATTGTAATTGTTTTGG + Intronic
1183234013 22:36602741-36602763 TGTTACCATTGTAATTGTTTTGG + Intronic
1183267989 22:36841670-36841692 TGTTACTATTGTAATTGCTTTGG + Intergenic
1183533314 22:38376629-38376651 TGTTACTATTGTAATTGTTTTGG - Intronic
1183764551 22:39859674-39859696 TGTTACTGTTGTAATTGTTTTGG - Intronic
1183889926 22:40918715-40918737 TGGTAAGATTGTCATTATTCTGG + Intronic
1184083009 22:42238810-42238832 TGTTACTTTTGTAATTGTTTTGG - Intronic
1184446737 22:44552027-44552049 CATTGCTATTGTCATTGTTTTGG + Intergenic
1185096923 22:48813896-48813918 TGTTACCATTGTAATTGTTTTGG + Intronic
1185353787 22:50353462-50353484 TGTTACTATTTTAATTGTTTTGG - Intronic
949391724 3:3569800-3569822 AGTTACTATTGTAATTGTTTTGG + Intergenic
949438377 3:4053303-4053325 TGTTACTATTGTAATTGTTTTGG - Intronic
949456980 3:4249492-4249514 TGTTACTATTGTAACTGTTTGGG + Intronic
949626407 3:5871710-5871732 TGTTACTATTGTAATTGTTTTGG + Intergenic
949975436 3:9453819-9453841 AGCTACTATTCTCATTGCTTTGG - Exonic
949984666 3:9531133-9531155 TGTTACTATTGTCATTGTTTTGG - Intronic
950246394 3:11423283-11423305 TGTTACTATTGTAATTGTTTTGG - Intronic
950562108 3:13737298-13737320 TGTTACTATTGTAATTGTTTTGG + Intergenic
950632404 3:14291487-14291509 TGTTACTATTGCAATCGTTTAGG + Intergenic
950700339 3:14740407-14740429 TGTTACTATTGTAATTGTTTGGG - Intronic
950929254 3:16772603-16772625 TGTTACTATCATAATTGTTTTGG - Intergenic
951042971 3:18008554-18008576 TGTTACTACTGTAATTGTTTTGG - Intronic
951112085 3:18815562-18815584 TGTTACCATTGTAATGGTTTGGG - Intergenic
951176346 3:19605313-19605335 TGTTACTATTGGAATTATTTTGG - Intergenic
951276168 3:20688792-20688814 TGTTACTATTGCAATTGTTTTGG - Intergenic
951306619 3:21071008-21071030 GATTACTATTGTAATTGTTTCGG + Intergenic
951307227 3:21079823-21079845 GGTTACTATTGTAATTGTTTTGG - Intergenic
951347373 3:21561781-21561803 TGTTACTATTGTGATTGTTTTGG - Intronic
951373298 3:21880442-21880464 TGTTACTATTGTAATGGTTTTGG + Intronic
951422175 3:22499783-22499805 TGTTACTCTTGTAATTGTTTGGG + Intergenic
951530083 3:23690716-23690738 TATTACTATTGTAACTGTTTTGG - Intergenic
951608847 3:24468691-24468713 TGTTACTGTTGTCATTGTTTTGG - Intronic
951769343 3:26238186-26238208 TGTTACTTTTGCCATTGTCTTGG - Intergenic
951851784 3:27149548-27149570 TGTCACTATTGTAATTGTTTTGG + Intronic
951862382 3:27267572-27267594 TGTTACTATTGTCATTGTTTTGG + Intronic
952003682 3:28815928-28815950 TTTTTCTATTGTAATTGTTTTGG - Intergenic
952110238 3:30114606-30114628 TAGTACTTTTGTTGTTGTTTTGG + Intergenic
952148093 3:30555632-30555654 TGGTAATTTTCTCATTGTCTAGG + Intergenic
952593502 3:34987461-34987483 TGTTACTATTGCAATTGTTTTGG + Intergenic
952639255 3:35572382-35572404 TGTTACTATTGCAATTGTCTAGG + Intergenic
952774837 3:37035280-37035302 CATTACTATTGTAATTGTTTGGG + Intronic
952899938 3:38103902-38103924 TGTTACTACTGTAATTGTTTTGG - Intronic
952957892 3:38570019-38570041 TGGTACTATTTTCACATTTTAGG + Intronic
953121655 3:40049424-40049446 TGTTACTATTATAATTGTTTGGG + Intronic
953174435 3:40536914-40536936 TGTTTCTATTGTAATTGTTTTGG + Exonic
953367208 3:42355296-42355318 AGTTACTATTGTAATTGTTTAGG + Intergenic
953436024 3:42878022-42878044 TGTTAGTACTGTAATTGTTTTGG + Intronic
953445707 3:42963870-42963892 TGTTAGTATTGTAATAGTTTTGG + Intronic
953483959 3:43276908-43276930 TGTTACTATTGTAATTGTTTGGG + Intergenic
953486833 3:43307572-43307594 TGTTACTATTGTAGTTGTTTTGG + Intronic
953837900 3:46363073-46363095 TGTCACTATTGTAGTTGTTTTGG + Intergenic
954020090 3:47732753-47732775 TGATACTATTTTAATTGCTTTGG - Intronic
954246211 3:49333718-49333740 TGTTGCTATTGTAATTGTTTTGG - Intronic
954373223 3:50180694-50180716 TGTTACTATTGCAATTATTTCGG - Intronic
954503568 3:51045379-51045401 TGTTACTATTGTAATTGTTCTGG - Intronic
954944588 3:54409292-54409314 CGTTACTATTGTAATTATTTTGG + Intronic
955164534 3:56498007-56498029 TGTCACTATTGTAATTGTTTTGG - Intergenic
955211147 3:56942401-56942423 TGTTACTATTGTAATTGTTTTGG + Intronic
955262723 3:57410348-57410370 TGTTACTATTGTAATTGTTTTGG + Intronic
955290333 3:57686663-57686685 TGTTACTATTGTAATTGTTTGGG + Intronic
955416622 3:58697973-58697995 CGTTACTATTGTAATTGTTTTGG - Intergenic
955617032 3:60820343-60820365 TGATCCTTTTGTTATTGTTTGGG - Intronic
955678309 3:61472746-61472768 TATTACTATTGTAATTGTTTTGG - Intergenic
955679587 3:61486633-61486655 TGTTACTATTGTAATTGTTTTGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
955938301 3:64123703-64123725 TATTACTATTGTAATTGTTTTGG + Intronic
955969793 3:64426967-64426989 TGTTACTATTGTAGTTGTTTTGG + Intronic
956063561 3:65373370-65373392 TGTTACTGTTGTAATTGTTTGGG - Intronic
956335660 3:68160621-68160643 AGGTGCTATTATAATTGTTTTGG - Intronic
956395224 3:68818776-68818798 CATTACTATTGTAATTGTTTTGG - Intronic
956851902 3:73236239-73236261 AAGTACTATTGACATAGTTTTGG + Intergenic
956942199 3:74176103-74176125 TGTTATTATTGTAATTGTTTTGG - Intergenic
956960611 3:74395946-74395968 TGTTACTATTGTAATTTTTGGGG + Intronic
956960743 3:74397403-74397425 TGTTACTACTGTAATTGTTTTGG + Intronic
957093554 3:75756185-75756207 TGCTACTATTGTCATTGTTTTGG + Intronic
957126327 3:76165969-76165991 TGTTACTATTGTAATGGTTTGGG - Intronic
957260267 3:77893003-77893025 TGTTAGTATTGTAACTGTTTTGG + Intergenic
957334864 3:78814989-78815011 TGTAACTATTGTAATTGTTTTGG + Intronic
957437271 3:80194518-80194540 CGTTACTATTGTAATTGTTTTGG - Intergenic
957499734 3:81038980-81039002 TGTTAATATTGTAATTGGTTTGG - Intergenic
957518671 3:81290205-81290227 TGTTACCACTGTAATTGTTTTGG - Intergenic
957536728 3:81515376-81515398 TGTTACTATTGTAATTGTTTTGG + Intronic
957645241 3:82913883-82913905 TGTTACTATTGTCATGGTTTTGG + Intergenic
957729761 3:84118683-84118705 AGGTTCTATGGTCAATGTTTGGG - Intergenic
957863738 3:85994822-85994844 TGTTTCCATTGTAATTGTTTTGG - Intronic
957928770 3:86849946-86849968 TGTTACTATTATAATTGTTTGGG + Intergenic
957996682 3:87699006-87699028 TGTTACTATTGTAATTGTTTTGG + Intergenic
958050965 3:88345612-88345634 TGTTACTGTTATAATTGTTTGGG + Intergenic
958096040 3:88946261-88946283 TTCTACTATTGTAAATGTTTTGG + Intergenic
958267739 3:91459467-91459489 TGTTACTAATGGAATTGTTTTGG + Intergenic
958492974 3:94801742-94801764 TGCTACTATAGTAATTGTTGTGG - Intergenic
958530089 3:95317214-95317236 TGTTACTATTTCAATTGTTTTGG - Intergenic
958633930 3:96718273-96718295 TGTTACTATTGTAATTGTTTTGG + Intergenic
958773261 3:98451456-98451478 TGTTACTATTGTAATTGTTTTGG - Intergenic
958800765 3:98752787-98752809 TGTTACTATTGTAATTGTTTTGG + Intronic
959165324 3:102769758-102769780 TAATACTATTGTAATTGTTTTGG - Intergenic
959210236 3:103369491-103369513 TGCTACTATTGTAATTGTTTTGG - Intergenic
959238598 3:103757797-103757819 TGTTACTATTATAATTGTTTTGG - Intergenic
959511130 3:107213808-107213830 TGTTACTACTGTAATTGCTTTGG + Intergenic
959546329 3:107601091-107601113 TGTTACTATTGTAATTGTTTTGG + Intronic
959721708 3:109498130-109498152 TGTTACTATTGTAATTGTTTTGG - Intergenic
959773075 3:110123288-110123310 TGTTACTATTGTAATTGTTTTGG + Intergenic
959799947 3:110481327-110481349 TGTTACTATTGTAACTGTTTTGG + Intergenic
960035674 3:113100609-113100631 TGCTACTATTGTGATTGTTTTGG - Intergenic
960044984 3:113188074-113188096 TGCTACTATTGTAATTGCTTTGG + Intergenic
960457933 3:117896679-117896701 TATTACTATTGTAATTGATTTGG + Intergenic
960549348 3:118956648-118956670 TATTACTGTTGTAATTGTTTCGG - Intronic
960599418 3:119440997-119441019 TATTACTACTGTAATTGTTTTGG + Intronic
960644087 3:119858958-119858980 TGTTACTATTGTGATTGTTTTGG - Intronic
960648092 3:119912297-119912319 TGTTACTATTGTAATTGTTTTGG - Intronic
960668993 3:120138837-120138859 TGTTACTATTGTGACTGTTTTGG + Intergenic
961227061 3:125260117-125260139 TGTTACTATTGTAATTGTTTTGG - Intronic
961411628 3:126726363-126726385 TGTTACTCTTGTAATTGTTTTGG - Intronic
961962210 3:130867042-130867064 TGTTACTATTGTAATTGTTGTGG + Intronic
962028901 3:131578277-131578299 TGTTACTGTTGTAATTATTTTGG + Intronic
962151110 3:132894217-132894239 GGGTACTATTGTCACTACTTGGG + Intergenic
962157446 3:132963059-132963081 TGTTACTATTATCATTGTTTTGG - Intergenic
962544150 3:136415017-136415039 ATGTTCTATTGTAATTGTTTTGG - Intronic
962711884 3:138094127-138094149 TGTTACTATTGTAATTGTTTTGG - Intronic
962836863 3:139197239-139197261 TGTTATTATTGTAATTGTTTTGG - Intronic
963081395 3:141397805-141397827 TGGTACTATTGTAATTGCTTTGG - Intronic
963195214 3:142520127-142520149 TGTTACTGTTGTAATTGCTTTGG + Intronic
963293235 3:143515227-143515249 TGTCACTATTGTAATTATTTAGG - Intronic
963455393 3:145540129-145540151 TATTACTATTGTAATTATTTTGG + Intergenic
963510698 3:146244567-146244589 TGTTACTATTATAATTGTTTTGG + Intronic
963584510 3:147167584-147167606 TGTTACTAATGTAATTGTTTTGG - Intergenic
963608809 3:147439391-147439413 TGTTACTATTGAAATTGTTTGGG - Intronic
963746716 3:149131496-149131518 TGTTACTATTGTAGTAGTTTTGG + Intronic
964061560 3:152530589-152530611 TATTACTATTGTAATTGTTTTGG - Intergenic
964076935 3:152703172-152703194 TGTTACCATTGCAATTGTTTTGG - Intergenic
964235955 3:154527811-154527833 TGTTACTATTGCAATTGTTTTGG - Intergenic
964398833 3:156277239-156277261 TGTTACTACTGTCATTGTTTTGG - Intronic
964535006 3:157711159-157711181 TGTTACTATTGTAATTGTCTTGG + Intergenic
964823285 3:160797260-160797282 TGTTACTATTGTTATTGTTTTGG + Intronic
964909393 3:161760082-161760104 TGATACTATTGTAATTGTTTTGG + Intergenic
964989797 3:162795009-162795031 TGTTGCTACTGTAATTGTTTGGG - Intergenic
965141489 3:164841745-164841767 TGTTACTATTGTAATTGTTTAGG + Intergenic
965224175 3:165966572-165966594 TGTTAATATTGTAATTGTTTGGG + Intergenic
965297747 3:166971052-166971074 TGATACTTTGGCCATTGTTTGGG + Intergenic
965352251 3:167628037-167628059 TGTTACTACTGTAATTGTTTTGG + Intronic
965424533 3:168505405-168505427 TGTTACTATTGTAATTGTTTTGG - Intergenic
965458974 3:168937711-168937733 CGTTACTATTGTGATTGTTTTGG - Intergenic
965702766 3:171475215-171475237 TGGTTTTGTTGTCATTGCTTTGG - Intergenic
965831269 3:172792133-172792155 TGTTACTATTGTAATTGTTTCGG - Intronic
965833462 3:172825165-172825187 TGTTATTATTGTAATTGTTCTGG + Intergenic
965886705 3:173455090-173455112 TGTTACTTTTGTAATTGTTTTGG - Intronic
965998773 3:174921005-174921027 TGTTACTATTGTAATTATTTGGG - Intronic
966065861 3:175820753-175820775 TGCTACTACTATAATTGTTTTGG - Intergenic
966070304 3:175869360-175869382 TGTTACTATTGTAACTGTTTTGG + Intergenic
966087590 3:176087646-176087668 TGATACTATTATAATTGTCTTGG - Intergenic
966503021 3:180667537-180667559 TGTTACTATTGTGATTGTTTTGG + Intronic
966663675 3:182446181-182446203 TGTTACTACTGTAGTTGTTTTGG + Intergenic
966750881 3:183321089-183321111 TGTTGCTATTGTAATTGTTTTGG - Intronic
966813990 3:183874170-183874192 TGTTACTACTGAAATTGTTTTGG + Intronic
966904501 3:184512379-184512401 TGTTATTATTTTCATAGTTTCGG - Intronic
966995834 3:185279447-185279469 TGTTACTATTGTAATTGTTTTGG - Intronic
967077617 3:186018256-186018278 TGCTACTATTGTAATTGTTTTGG - Intergenic
967400390 3:189054328-189054350 TGTTAATATTGTAATTGTTTTGG - Intronic
967571696 3:191036833-191036855 TGTTACTATGGTAATTGTTTTGG + Intergenic
967603635 3:191417990-191418012 TGTTACTATTGTAATTGTTTTGG + Intergenic
967661517 3:192116157-192116179 TGTTACTGTTGTAATTGTTTTGG - Intergenic
967710799 3:192705589-192705611 TGCTATTATTGTAATTGTTTTGG - Intronic
967725024 3:192853901-192853923 TGTTACTATTGTAATTGTCTTGG + Intronic
967763459 3:193251311-193251333 TGGGAATGTTGTCCTTGTTTAGG + Intronic
968244544 3:197129889-197129911 TGTTACTATTTTAATTGTTTTGG - Intronic
1202740171 3_GL000221v1_random:47078-47100 TGCTACTGTTGTCATTGTTTTGG + Intergenic
969050379 4:4368831-4368853 ACTTACTATTGTTATTGTTTGGG + Intronic
970284693 4:14497442-14497464 TATTACTATTTGCATTGTTTAGG - Intergenic
970332027 4:14996408-14996430 TGTTACTAGTGTAACTGTTTTGG + Intergenic
970390414 4:15604428-15604450 TGTTACTATTGTAATTGCTTTGG - Intergenic
970567008 4:17341274-17341296 TGTTATTATTGTCATGTTTTTGG - Intergenic
970578789 4:17454108-17454130 TGCTACTATTATAATTGTTTTGG + Intergenic
970605394 4:17676354-17676376 TGTTGCTATTGTAATTGTTTTGG - Intronic
970622640 4:17840005-17840027 TGGTACTATTTTCAAAGATTAGG + Intronic
970664327 4:18319468-18319490 TTTTAGTATTGTTATTGTTTGGG - Intergenic
970732115 4:19117951-19117973 GGGTAGTAATGTCATTCTTTTGG + Intergenic
971071158 4:23093741-23093763 TGTTAATATTGTAATAGTTTTGG + Intergenic
971086077 4:23276675-23276697 TGTTACTATTGTGATTGTTTTGG + Intergenic
971102652 4:23484893-23484915 TGATCCTATTGTGTTTGTTTTGG - Intergenic
971142704 4:23941852-23941874 TGATATTATAGTCATTCTTTAGG - Intergenic
971295561 4:25386548-25386570 TGTTACTATTATAATTGTTTAGG - Intronic
971398603 4:26254134-26254156 GGATGCTATTGTCCTTGTTTAGG - Intronic
971441258 4:26689664-26689686 TGTTACTACTGTAATTATTTTGG + Intronic
971679862 4:29683906-29683928 TGTTACTATCAACATTGTTTTGG + Intergenic
971709068 4:30088106-30088128 TGTTACTATTGTAATTGTTTTGG - Intergenic
971918253 4:32903700-32903722 TGTTACTATTGTAACTGTTTTGG - Intergenic
972189361 4:36571269-36571291 TGATACTATTTTAATTATTTAGG - Intergenic
972281716 4:37608023-37608045 TGTTACTATTGTAATTGTTTTGG + Intronic
972383723 4:38543447-38543469 TGTTATTATTATAATTGTTTTGG - Intergenic
972560302 4:40221545-40221567 TGTTACTGTTGCAATTGTTTTGG + Intronic
972615425 4:40693640-40693662 TGTTACTATTGTAATTGTTTTGG - Intergenic
972747624 4:41953771-41953793 TGTTACTATTGTAACTGTTTTGG - Intronic
972997821 4:44904358-44904380 GGGTACTATGTTCATTATTTGGG + Intergenic
973000691 4:44945516-44945538 TATTACTATTGTAATTATTTTGG + Intergenic
973055135 4:45647665-45647687 TATTATTATTGTAATTGTTTAGG - Intergenic
973128154 4:46614791-46614813 TGTTACTATCATAATTGTTTTGG + Intergenic
973233860 4:47874539-47874561 TGTTTCCATTGTAATTGTTTTGG - Intronic
973235300 4:47896114-47896136 TGTTACTATTGTGATTGTTTGGG - Intronic
973396888 4:49602202-49602224 TGCTACTGTTGTCATTGTTTTGG + Intergenic
973658391 4:53075761-53075783 TGTTACAATTATAATTGTTTGGG - Intronic
974212064 4:58791015-58791037 TGGTACTATTGTCACTGTTTTGG + Intergenic
974423339 4:61707179-61707201 TGTAACTATTTTAATTGTTTTGG - Intronic
974471582 4:62325749-62325771 TGTTACTATTGTAATTGTTTGGG + Intergenic
974531429 4:63112983-63113005 TGTTACTAATGTAATTGTCTTGG - Intergenic
974660188 4:64877692-64877714 TGTTACTATTCTAATTGTTTTGG - Intergenic
974816955 4:67017362-67017384 TGCTACTATTATAATTGTTTAGG - Intergenic
974859322 4:67500032-67500054 CATTACTATTGTAATTGTTTTGG - Intronic
975240703 4:72055347-72055369 TGCTATTATTGTAATTGTTTTGG + Intronic
975322993 4:73029216-73029238 TATTATTATTGTAATTGTTTAGG + Intergenic
975475526 4:74819067-74819089 TGTTACTGTGGTAATTGTTTTGG - Intergenic
975478279 4:74847904-74847926 TGTTACAATTATAATTGTTTTGG + Intergenic
975567881 4:75779068-75779090 TGTTACTATTGTAATTGTTTTGG + Intronic
975880105 4:78895033-78895055 TGTTACTACTGTAATTGTTTTGG - Intronic
975940657 4:79641372-79641394 TGTCACTATTGCAATTGTTTTGG + Intergenic
976154453 4:82127575-82127597 TGTGACTAATGTAATTGTTTTGG + Intergenic
976465462 4:85363233-85363255 TGTTACTATTGTAATTCTTTTGG - Intergenic
976647016 4:87397276-87397298 TGTTACTATTGTAATTGTTTTGG - Intergenic
976744455 4:88389414-88389436 AGGTGCTATTGTCATTTTTTAGG + Intronic
976835304 4:89365739-89365761 TGTTACTATTGTAATTGTTTTGG + Intergenic
976847428 4:89505896-89505918 TTGGACTAATCTCATTGTTTTGG - Intergenic
976885361 4:89976796-89976818 TGTTACTATTGTACTTGTTTTGG - Intergenic
976991545 4:91373477-91373499 TGCTACTGTTTTAATTGTTTTGG + Intronic
977169444 4:93742659-93742681 TGTTACTATCATAATTGTTTTGG + Intronic
977194461 4:94042280-94042302 TGTTACTATTGTATTTGTTTTGG - Intergenic
977225829 4:94390452-94390474 TGTTACTACTGGAATTGTTTAGG - Intergenic
977356062 4:95948347-95948369 TATTACTATTGTAATTGTTTTGG - Intergenic
977434989 4:96982998-96983020 TGTTACTATTGTAATAGTTTGGG - Intergenic
977539317 4:98297556-98297578 TGTTACTATTGTGATTGTTTTGG + Intronic
977568083 4:98602043-98602065 TGTTACTATTGTAATTGTTTTGG - Intronic
977597077 4:98895095-98895117 TGTTGCTATTATAATTGTTTTGG - Intronic
977715133 4:100173639-100173661 TCTTACTATTGTAATTTTTTGGG - Intergenic
977852835 4:101850798-101850820 TGTTACCATTGTGATTGTTTTGG + Intronic
977889178 4:102288268-102288290 TGTTACTATTGTCATTGTTTTGG + Intronic
977981275 4:103325341-103325363 TGTTACTATTATAATTGTTCTGG - Intergenic
977992492 4:103461373-103461395 TGTTACTATCATAATTGTTTCGG - Intergenic
978010277 4:103673540-103673562 TGTTACTCTGGTAATTGTTTTGG - Intronic
978125871 4:105134603-105134625 TGTTACTATTGTAATTATTTTGG - Intergenic
978181312 4:105799644-105799666 TGTTACTATTGAAATTATTTTGG - Intronic
978212134 4:106149619-106149641 TGTTGCTATTGTACTTGTTTTGG - Intronic
978308731 4:107361993-107362015 TGTTACTATTTTAATTATTTTGG - Intergenic
978523603 4:109641465-109641487 TGTTACTATTGTAATTATTTTGG - Intronic
978610977 4:110539001-110539023 TTTTACTATTGCAATTGTTTTGG - Intronic
978676981 4:111330327-111330349 TGTTACTATTGTAATTGTTTTGG + Intergenic
978763066 4:112376080-112376102 TGTTATTATTGTAATTATTTTGG - Intronic
979186725 4:117805604-117805626 TGTTACTATTATAATTGTTTTGG - Intergenic
979190048 4:117845686-117845708 TGTTACTATTGTAATTGCTTTGG + Intergenic
979197958 4:117942392-117942414 TTTTACTATTGTAAATGTTTTGG + Intergenic
979267193 4:118717284-118717306 TGTTACTATCATAATTGTTTTGG - Intergenic
979374356 4:119928033-119928055 TGTTACTATTGTAATCATTTGGG + Intergenic
979384370 4:120046800-120046822 TGTTACTATTGTGATTATTTTGG - Intergenic
979448818 4:120844517-120844539 TGTTACTATTGTAATTGTTTAGG + Intronic
979575119 4:122281138-122281160 TGTTATTATTGTTATTGTTGGGG + Intronic
979625230 4:122837078-122837100 TGGTACCATTGTTAATATTTTGG + Intronic
979729467 4:124006504-124006526 TGTTACTATTGTAATTGTATTGG - Intergenic
979744481 4:124194170-124194192 TGATACTATTGTAATTGTTCTGG - Intergenic
979823221 4:125200438-125200460 TGTTACTATTGTAATTGTTTTGG + Intergenic
979895634 4:126153007-126153029 TGTTATTATTGTAATTGTTTTGG + Intergenic
980187879 4:129484921-129484943 TGTTACTATTGTAATTGTTTGGG - Intergenic
980221309 4:129919529-129919551 TGTTACTATTGTAATTGCTTTGG + Intergenic
980298978 4:130963738-130963760 TGTTACTATTGTAACTTTTTGGG + Intergenic
980374699 4:131929123-131929145 TGTTACTATTGTAATTGTTTTGG - Intergenic
980393847 4:132182310-132182332 TGTTACTATTGTAATTATTTTGG - Intergenic
980546576 4:134271194-134271216 TATTTCTATTGTAATTGTTTTGG + Intergenic
980549721 4:134318880-134318902 TGTTACTATTGTAATTGTTTTGG - Intergenic
980555550 4:134398898-134398920 TGTTAGTATTGTAATTGTTATGG - Intergenic
980671318 4:136010004-136010026 TGGTATTATTTTCAGGGTTTTGG - Intergenic
981119627 4:141034828-141034850 TGTTACTATTGTACTTGTTTGGG - Intronic
981164188 4:141537605-141537627 TGTTACTATTGTGATTGTTAGGG - Intergenic
981220840 4:142232443-142232465 TATTACTATTGTAATTATTTTGG + Intronic
981439363 4:144765560-144765582 GGTTACTACTGTAATTGTTTTGG - Intergenic
981462132 4:145025595-145025617 TGCTACTATTGTCATTGTTATGG - Intronic
981464424 4:145051334-145051356 TGATACTATTGTAATTGTTTTGG - Intronic
981564761 4:146088115-146088137 TGTTTCTATTTTAATTGTTTTGG - Intergenic
981628658 4:146791410-146791432 TGTTATTATTGTAATTGTTTTGG + Intronic
981683428 4:147426419-147426441 TGTTACTCTTTTAATTGTTTGGG + Intergenic
981764581 4:148233790-148233812 TGTTGCTATTGTAATTGCTTTGG - Intronic
981899038 4:149840321-149840343 TATTACTATTGTAATTGTTTAGG - Intergenic
981984787 4:150840602-150840624 TATTACTATTGTAATTGTCTTGG - Intronic
982148219 4:152421893-152421915 TGTTACTATCATAATTGTTTGGG - Intronic
982149385 4:152435918-152435940 TGTTACTACTGTAATTGTTTTGG + Intronic
982169976 4:152652076-152652098 TATTACTGTTGTAATTGTTTTGG - Intronic
982247860 4:153372106-153372128 TGTTACTATTGTAATTGTTTTGG - Intronic
982300414 4:153872944-153872966 TGTTACTGTTGTAATTGTTTTGG + Intergenic
982344653 4:154344149-154344171 TATTATTATTGTAATTGTTTGGG - Intronic
982488176 4:155994261-155994283 TGTTACTATTATGATAGTTTTGG - Intergenic
982520672 4:156412750-156412772 TGTTGCTATTGTGATTGTTTTGG - Intergenic
982575691 4:157107066-157107088 TGTTACTGTTGTAATTGTTTTGG + Intronic
982903111 4:161032101-161032123 TGTTGCTATTGTAATTGTTTTGG - Intergenic
983086713 4:163454043-163454065 TGTTACTATCGTAATTGTTTGGG - Intergenic
983128974 4:163990819-163990841 AAGTAATATTGTCAGTGTTTAGG + Intronic
983136976 4:164096461-164096483 TGGTACTATGTTCATTATCTGGG + Intronic
983161470 4:164420919-164420941 TGTTACTATTGCAGTTGTTTTGG + Intergenic
983658502 4:170107705-170107727 TTTTACTACTGTAATTGTTTGGG - Intergenic
983758183 4:171368896-171368918 TGTTACCATTGTAATTATTTTGG + Intergenic
983764425 4:171459985-171460007 TGTTACTACTGTAATGGTTTTGG - Intergenic
983808592 4:172027410-172027432 TATTACTATTATAATTGTTTTGG + Intronic
983963232 4:173779289-173779311 TGTTACTATTATAATTGTTTTGG + Intergenic
984054754 4:174913513-174913535 TGTAACTGTTGTGATTGTTTTGG - Intronic
984339964 4:178444573-178444595 TGGTATTATTGACATTTATTAGG + Intergenic
984351183 4:178595950-178595972 TTGTTCTATTGTCATTGTGTAGG + Intergenic
984438949 4:179741228-179741250 CGTTACTATTGCAATTGTTTTGG + Intergenic
984454118 4:179943598-179943620 TGTTATTGTTGTAATTGTTTTGG - Intergenic
984461076 4:180037585-180037607 TGTTACTATTGTAATTATTTTGG + Intergenic
984479112 4:180276275-180276297 TGTTACTGTTGTAATTGTTTTGG + Intergenic
984637146 4:182123628-182123650 TGTTACTATTGTAATTGTTTTGG - Intergenic
984822944 4:183899098-183899120 TGTTATTATTGTAATTGTTTTGG + Intronic
984967930 4:185156966-185156988 TGGTACTATGCTCATTGCCTGGG + Intergenic
985058192 4:186053774-186053796 TGTTACTATTGAAATTGTTTTGG + Intergenic
985088071 4:186334743-186334765 TGATACTATTGTAATTGTTTGGG + Intergenic
985188349 4:187343180-187343202 TGTTACTATTGTAACTGTTTTGG - Intergenic
985311111 4:188600532-188600554 TGTTACTATTGCAATTGTTCTGG - Intergenic
1202761509 4_GL000008v2_random:115668-115690 TGCTACTGTTGTCATTGTTTTGG - Intergenic
985481758 5:116309-116331 TGTTACTATTGTAATTGTTTTGG - Intergenic
985900425 5:2784850-2784872 CGTTACTCTTGTAATTGTTTTGG + Intergenic
986506131 5:8454002-8454024 TGTTACTATTATAATTGCTTGGG + Intergenic
986593295 5:9393728-9393750 TGGTTTTATTGTCTTTTTTTAGG - Intronic
986618078 5:9640302-9640324 TGTTCCTATTGTAATTGTTTGGG - Intronic
986682203 5:10244200-10244222 TGTTTCTATTGTAAATGTTTTGG - Intronic
986738633 5:10686102-10686124 TGTTACTACTGTAATTGTTTTGG + Intronic
986752799 5:10804611-10804633 TGTTACTATTGTAATTGTGTTGG + Intergenic
986776426 5:11018192-11018214 TATTACTACTGTAATTGTTTTGG + Intronic
986928555 5:12790451-12790473 TGTTACTATTGTAATGGTTTGGG - Intergenic
986941575 5:12957016-12957038 TGTTACTATTATAATTGTTTTGG + Intergenic
987124471 5:14798684-14798706 TGTGACTATTTTAATTGTTTTGG + Intronic
987279927 5:16402596-16402618 TGTTACTATTGTAAGTGTTTTGG - Intergenic
987328936 5:16837946-16837968 TGCTCCTATTGTAATTGTTTGGG + Intronic
987529362 5:19097520-19097542 TGTTACTATTGTAACTGTTTTGG + Intergenic
987626238 5:20404633-20404655 TGTTACTATTGTAATTTTTTTGG - Intronic
987655801 5:20804492-20804514 TGTTCCTATTGTAATTGTTTTGG + Intergenic
987665349 5:20931418-20931440 TGTTACTATTGTTATTGTTTGGG - Intergenic
987683705 5:21169363-21169385 TGTTACTCTTGTCATTGATTGGG - Intergenic
987726651 5:21709297-21709319 TGTTACTACTGTAATTGTTTTGG + Intergenic
987797234 5:22643935-22643957 GGTTACTATTGTGATTGGTTTGG + Intronic
987978064 5:25042050-25042072 TATTACTATTGTAATTGTTTTGG + Intergenic
987982409 5:25103232-25103254 TGTTACTATTATAATTGGTTTGG - Intergenic
988160424 5:27513180-27513202 TGTTTCTATTGTAATTGTTTTGG + Intergenic
988174953 5:27710848-27710870 TGTTACTATGGTTATTGTTTTGG + Intergenic
988274395 5:29062454-29062476 TGTTACTAAGGTAATTGTTTGGG + Intergenic
988330370 5:29830395-29830417 TGTTACTATTGTAATTGTTTTGG - Intergenic
988431596 5:31125433-31125455 TGTTACTATTGTAATTGTTCCGG + Intergenic
988441238 5:31236251-31236273 TGTGAATATTGTCATTATTTAGG - Intronic
988669781 5:33368939-33368961 TATTATTATTGTAATTGTTTTGG - Intergenic
988757347 5:34270765-34270787 TGTTACCATTGTTATTGTTTGGG + Intergenic
988767753 5:34399415-34399437 TGTTCCTATTGTAATTGTTTTGG - Intergenic
989225133 5:39018599-39018621 TGTAACTATTATCATTGTTATGG + Intronic
989324683 5:40178316-40178338 TGCTACTGTTTTAATTGTTTTGG - Intergenic
989391955 5:40909932-40909954 TAGTACTATTGTTATTTCTTGGG + Intronic
989634083 5:43516042-43516064 TGTCACTACTGTAATTGTTTTGG + Intergenic
989654114 5:43725982-43726004 TGTTACTATTGTAATCGTTTTGG - Intergenic
989729280 5:44628959-44628981 TGTTACTATTGTAATTATTTTGG + Intergenic
989760117 5:45005258-45005280 TGTTACTACTGTAATTGTTTTGG + Intergenic
989952904 5:50322137-50322159 TGTTACCATTGTAATTGTTTTGG + Intergenic
990003036 5:50917352-50917374 TGTTACTATTGAAATTATTTTGG - Intergenic
990112099 5:52339302-52339324 TGTAACCATTGTAATTGTTTTGG + Intergenic
990222683 5:53610358-53610380 TGTTACTATTGTAATTGTTTTGG - Intronic
990481565 5:56216211-56216233 TGTTACTATTGTAATTGTTTTGG + Intronic
990523190 5:56599621-56599643 TGTTGCCATTGTAATTGTTTTGG - Intronic
990571869 5:57087073-57087095 TGTTACCATTGTAACTGTTTTGG + Intergenic
990697500 5:58436988-58437010 TGTTACTATTGTAATTTTTTGGG - Intergenic
990788755 5:59453143-59453165 TGTTACTATTGTAATTGTTTAGG + Intronic
990874581 5:60469715-60469737 TGCTACTGTTGTAATTGTTTTGG + Intronic
990887471 5:60611210-60611232 TGTTACTACTGTAAGTGTTTGGG + Intronic
990979385 5:61588118-61588140 TATTACTATTGTATTTGTTTTGG + Intergenic
991060991 5:62375868-62375890 TGGAACTACTGACATTGTATGGG - Intronic
991104199 5:62825608-62825630 TGTTACTATTGTAATGATTTTGG + Intergenic
991104202 5:62825653-62825675 TGTTACTATTGTAATTATTTTGG + Intergenic
991134884 5:63170020-63170042 TCGTTCTACTGTCATTGTTTTGG + Intergenic
991143137 5:63269885-63269907 CAGTATTATTGTCATTGTCTTGG - Intergenic
991191826 5:63883402-63883424 AGTTACTATTGTAATTGTTTGGG - Intergenic
991228612 5:64303112-64303134 TATTACTATTGTAATTGTTTTGG + Intronic
991273860 5:64819880-64819902 TGGTATTATGGTCATAGTTTGGG + Intronic
991651391 5:68858501-68858523 TGTTACTATTGTAATTGTTTTGG - Intergenic
991936250 5:71803735-71803757 TGTTACTATTGCAGTTGTTTTGG - Intergenic
992034077 5:72753864-72753886 TGGTACTATAGTGGGTGTTTTGG - Intergenic
992074545 5:73178930-73178952 TGTTACTGTTGTAAATGTTTTGG + Intergenic
992106869 5:73456446-73456468 AGGTACTATTTTCACTATTTGGG - Intergenic
992127950 5:73661792-73661814 TGATGTTATTGTCATTGTTTTGG - Intronic
992362959 5:76061075-76061097 TGTTACTATTGTAATTGTTTTGG - Intergenic
992426648 5:76664364-76664386 TGTTACTATTGTAATTGTTTTGG - Intronic
992598399 5:78369465-78369487 TGTTACTACTGTAATTGTCTTGG - Intronic
992730578 5:79663653-79663675 TGTTACTACTGTAATTGTTTTGG - Intronic
992918355 5:81483126-81483148 TGTGACTATTGTAATTGTTTTGG - Intronic
992935640 5:81701315-81701337 TGCTACTGTTGAAATTGTTTTGG - Intronic
993124341 5:83814117-83814139 TGTTACTGTTGTAATTGTTTTGG - Intergenic
993349619 5:86832581-86832603 TGTTACTATTGTAATTGTTTTGG - Intergenic
993393600 5:87354436-87354458 TGTTACTATTGCAATTGTTTTGG + Intronic
993400472 5:87443605-87443627 TGTCGCTATTGTAATTGTTTTGG - Intergenic
993599825 5:89907938-89907960 TGGTACTATTGTCATTGTTTTGG - Intergenic
993925772 5:93864054-93864076 TGATACTATTGACATTTGTTAGG - Intronic
994155591 5:96500088-96500110 TGCTACTATTGTAATTTTTTTGG - Intergenic
994170916 5:96659125-96659147 TGTTGCTATTGTAATTATTTTGG - Intronic
994253608 5:97566504-97566526 TGTTACTATTGTAATTGTTTTGG + Intergenic
994439708 5:99786998-99787020 AGGTATTATTGTCAGTGTTTTGG + Intergenic
994603359 5:101936560-101936582 GAGTACTATGGTCATTATTTGGG - Intergenic
994736755 5:103565419-103565441 TGTTACTATTGTAATTGTTTTGG + Intergenic
994807865 5:104475505-104475527 TGTTACTATTGTAATTGTTTTGG - Intergenic
994828304 5:104744837-104744859 TGGTACAATGGTCACTATTTGGG + Intergenic
994851411 5:105058395-105058417 TGTTACTATTGTAATTGTTTTGG + Intergenic
994937191 5:106270143-106270165 TGTCACTATTGTAATTGTTTTGG - Intergenic
994961041 5:106603240-106603262 TGTTACTATTGTGATTGTTTGGG + Intergenic
994967121 5:106688350-106688372 TGTTACTATTGTAATTGTTCTGG + Intergenic
995291450 5:110460853-110460875 TGTAACTATTGTAATTGTTTTGG + Intronic
995339587 5:111042839-111042861 TGTTACTATCATAATTGTTTTGG - Intergenic
995431233 5:112080201-112080223 TGTTACTATTGTACTTGTTTTGG + Intergenic
995581194 5:113604982-113605004 TTGTACTTTTTCCATTGTTTTGG - Intergenic
995736103 5:115300963-115300985 TGTTACCATTTTAATTGTTTTGG + Intergenic
995741616 5:115361750-115361772 TGTTACTATTATAATTGTCTTGG - Intergenic
995886936 5:116905791-116905813 TGTTACTATTGTAATTATTTTGG + Intergenic
996045810 5:118872627-118872649 TGTTACTTTTGTGATTGTTTTGG - Intronic
996067319 5:119093481-119093503 TGTTACTATTGTAATGGTTGTGG + Intronic
996072826 5:119153994-119154016 TGTTACTATTATAATGGTTTTGG + Intronic
996194468 5:120586605-120586627 TGTTACTATTGTAATTCTTTGGG + Intronic
996351949 5:122553736-122553758 TGTTGCTATTGTAATTGTTTTGG + Intergenic
996380521 5:122858183-122858205 AGTTACTACTGTAATTGTTTTGG - Intronic
996512524 5:124332907-124332929 AGTTACTATTGTAATTGTTTTGG - Intergenic
996807456 5:127472732-127472754 TATTACTATTGTAATTGTTTTGG - Intergenic
996841978 5:127856850-127856872 TATTACTATTGTTATTGTTTTGG - Intergenic
996847613 5:127917704-127917726 TGTTACCGTTGTAATTGTTTTGG - Intergenic
997162901 5:131627906-131627928 TGTTACTACTGTAATTGTTTTGG + Intronic
997176196 5:131780656-131780678 TGTTACTATTGTAATTGTTTTGG + Intronic
997483922 5:134212386-134212408 TGTTACTATTGTAATTGCTGTGG + Intronic
997566660 5:134892920-134892942 TGTTACTATTGTAATTGTTTTGG - Intronic
997572436 5:134941265-134941287 AGGTTTAATTGTCATTGTTTTGG + Intronic
997695089 5:135855089-135855111 TGCTACTAATGTCATTGTTTGGG - Intronic
997740953 5:136253569-136253591 TGTTACTATTGTAACTGATTGGG + Intronic
997835443 5:137188490-137188512 TGTTACTATTGTATTTGTCTTGG + Intronic
998719110 5:144923056-144923078 TGTTACTATTTCAATTGTTTGGG + Intergenic
998831470 5:146164035-146164057 TGTTATTATTCTAATTGTTTTGG - Intronic
998863643 5:146472466-146472488 TGTTACTGTTGTAATTGTTTTGG + Intronic
999039280 5:148389177-148389199 TGTTACTACTTTAATTGTTTTGG - Intronic
999524666 5:152391488-152391510 TATTACTATTGTAATTATTTTGG - Intergenic
999575846 5:152975780-152975802 AATTACTATTGTAATTGTTTGGG + Intergenic
999835161 5:155362296-155362318 TGTTACTATTGTAATTATTCAGG - Intergenic
999851040 5:155539443-155539465 TAATATTATTGTCATTGATTTGG - Intergenic
999853565 5:155569055-155569077 TGGTACTATGCTCATTACTTGGG - Intergenic
999897090 5:156046595-156046617 TGTTACTATTGTAATTGATTTGG + Intronic
1000080910 5:157845934-157845956 TGTTACTATTGTAATTGTTTGGG + Intronic
1000129261 5:158279634-158279656 TGTCACTATTGTAATTGTTTTGG + Intergenic
1000333314 5:160223267-160223289 TGTTACCATTGTAATTGTTTTGG + Intronic
1000389275 5:160706116-160706138 TGTTACTATTGTAATCATTTTGG - Intronic
1000453797 5:161423537-161423559 CATTACTATTGTAATTGTTTTGG + Intronic
1000462653 5:161542162-161542184 TGTTACTATTGCAATTGTTTGGG - Intronic
1000657477 5:163898182-163898204 TGTTACTATTGTGATTGTTTTGG + Intergenic
1000729050 5:164808568-164808590 TGGTTCTTTTGTTGTTGTTTTGG + Intergenic
1000758238 5:165187239-165187261 TGTTACTATTATAATTGGTTGGG + Intergenic
1000821256 5:165987163-165987185 TGTCACTATTGTAATTGTTTTGG + Intergenic
1000886679 5:166755642-166755664 TGTTACTATTGTAATTGTTTTGG + Intergenic
1001655859 5:173349102-173349124 TGTTACTATTGTAATTGTTTTGG + Intergenic
1002508415 5:179696996-179697018 TGTTACTATTGTAATTGCTTTGG + Intronic
1002813088 6:653025-653047 TGATACTATTGTAACTGTTCCGG + Intronic
1002881715 6:1258253-1258275 TGTTACTATTGTAATTGTTTTGG + Intergenic
1002985053 6:2181657-2181679 TGTTACCACTGTAATTGTTTAGG + Intronic
1003008045 6:2399827-2399849 TGTTACTATTGTAATTGTTTTGG + Intergenic
1003085641 6:3058735-3058757 TGTTACTACTATAATTGTTTTGG + Intergenic
1003275076 6:4643469-4643491 TGTTACCATTGTAATTGTTTTGG - Intergenic
1003473166 6:6456170-6456192 TGTTATTATTGTCATTATTTGGG + Intergenic
1003598784 6:7499473-7499495 TGTCACTATTGTGATTGTTTTGG - Intergenic
1003659870 6:8050254-8050276 TGTTACTGTTGTCATAGTTTTGG + Intronic
1004440955 6:15653344-15653366 TGGTAGTTTTGTGTTTGTTTGGG + Intronic
1004658160 6:17684930-17684952 TATTACTATTGTAATTGTTTTGG - Intronic
1004922826 6:20392976-20392998 TGTTACTATTGTAATTGTTTTGG - Intergenic
1004978608 6:20996607-20996629 TGTTACTCTTGTAATTATTTTGG - Intronic
1005365798 6:25075615-25075637 TGTTACTATTCTAATTGTTTTGG - Intergenic
1005402249 6:25446988-25447010 TGTTACTATTGTAACTATTTTGG - Intronic
1005437504 6:25830766-25830788 TTTTACTTTTGTGATTGTTTTGG + Intronic
1005663815 6:28028663-28028685 CGTTACTATTGGAATTGTTTTGG + Intergenic
1005689878 6:28293689-28293711 TGTTACTATTGAATTTGTTTTGG + Intronic
1005914223 6:30338551-30338573 TGTTACTATTGTAATCGTTATGG - Intronic
1006245213 6:32727930-32727952 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1007017778 6:38486646-38486668 TGTTACTATTGTAATTGTTTTGG - Intronic
1007650896 6:43420912-43420934 TGTTACTATTGTAATTGTTTTGG + Intergenic
1007863815 6:44945130-44945152 TGTTACTATTGTAATTGTCTTGG + Intronic
1007884222 6:45207708-45207730 TGCTACCACTGTAATTGTTTGGG + Intronic
1007972183 6:46063350-46063372 TGGTACTGTTGTATTTGTTAAGG - Intronic
1008120781 6:47614525-47614547 TGTTAATATTGTAATTGTTCTGG - Intronic
1008125771 6:47666668-47666690 TGTTACTATTATAATTGTTTTGG + Intronic
1008161160 6:48077861-48077883 TGGTACTATTGTAATTGTTTTGG - Intergenic
1008319414 6:50089661-50089683 AGTTACTATTGTAATTGTTTTGG + Intergenic
1008346224 6:50430284-50430306 TGTTACTATTGTGAATGTTGTGG + Intergenic
1008516304 6:52322634-52322656 TGTTACTATTGCAATCGTTTTGG - Intergenic
1008733198 6:54508324-54508346 TGTTACTATTGGAATTGTTTGGG - Intergenic
1008761159 6:54852390-54852412 TGTTACTCTTGTAATTTTTTGGG + Intronic
1008805677 6:55424496-55424518 TGTTACAACTGTAATTGTTTTGG - Intergenic
1008839372 6:55881708-55881730 TATTATTATTATCATTGTTTTGG - Intergenic
1008975175 6:57417648-57417670 TGTTACTAATGTAATTGTTTTGG - Intronic
1008987476 6:57562117-57562139 TGTTACTAATGGAATTGTTTTGG - Intronic
1009164060 6:60319167-60319189 TGTTACTAATGTAATTGTTTTGG - Intergenic
1009175431 6:60454674-60454696 TGTTACTAATGGAATTGTTTTGG - Intergenic
1009240520 6:61180581-61180603 TGTTACTATTGTAATGGTTTTGG + Intergenic
1009479381 6:64137731-64137753 TATTACTACTGTCATTGTTTTGG - Intronic
1009573552 6:65421894-65421916 TGTTACTATTGTAATTGCTTTGG - Intronic
1009590011 6:65656053-65656075 TGTTACCATTGTAATTGTTTTGG + Intronic
1009627304 6:66151740-66151762 TGTTACTATTGTAGTAGTTTTGG + Intergenic
1009647342 6:66423691-66423713 TGTTACTATTGGAATTGTTTTGG + Intergenic
1009870646 6:69449320-69449342 TGTTATTATTGTAATTGTTTTGG + Intergenic
1010050045 6:71492979-71493001 TATTACTATTGTAATAGTTTTGG + Intergenic
1010050289 6:71496246-71496268 TAGTAATATTGTTATTGTCTAGG + Intergenic
1010114094 6:72280972-72280994 TGGTATTATTGCCACTTTTTAGG + Intronic
1010288821 6:74111940-74111962 CGTTACTATTATAATTGTTTGGG + Intergenic
1010964317 6:82186060-82186082 TGTTACTATTATAATTGTTTTGG + Intronic
1011019780 6:82799587-82799609 TACTACTATTGTAACTGTTTTGG + Intergenic
1011029402 6:82905375-82905397 TGTTACTATTGTAATTATTTTGG + Intronic
1011075050 6:83430534-83430556 TGATACTACTTTCATTGTCTGGG + Intronic
1011115655 6:83888509-83888531 TGTTACTATTGTAATAGTTTTGG + Intronic
1011178673 6:84593782-84593804 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1011587866 6:88946263-88946285 TGTTACAACTGTAATTGTTTTGG + Intronic
1011653613 6:89529893-89529915 TGTTACTACTGTAATTGTTTTGG - Intronic
1011694554 6:89900449-89900471 TCTTGCTATTGTCATTGTTTTGG + Intergenic
1011829104 6:91349078-91349100 TGCTGCTGTTGTAATTGTTTTGG + Intergenic
1011856530 6:91699754-91699776 TGTTACTATTGTAATTGTTTCGG - Intergenic
1011872751 6:91916976-91916998 TGGTGCTATTGTAATTGTTTTGG + Intergenic
1011935611 6:92772898-92772920 TGTTACTATTGTAATTGGTTTGG - Intergenic
1011976919 6:93312997-93313019 TGTTACTACTGTAATTGTCTGGG - Intronic
1012012714 6:93810641-93810663 TGATACTATTGTAATTGTTTTGG + Intergenic
1012200364 6:96398771-96398793 GGGTACTATCTTCATTATTTTGG + Intergenic
1012254094 6:97012878-97012900 TATTATTATTGTTATTGTTTTGG + Intronic
1012262574 6:97104775-97104797 TGGTAACATTTTCATTGTTCTGG + Intronic
1012287687 6:97412922-97412944 TGTTGCGATTGTAATTGTTTTGG - Intergenic
1012800001 6:103813914-103813936 TGTTACTATTGTAATTGTTTTGG - Intergenic
1012965079 6:105665372-105665394 TGTTGCCATTGTAATTGTTTTGG - Intergenic
1012983320 6:105852283-105852305 TATTACTATTCTAATTGTTTTGG - Intergenic
1013027288 6:106288408-106288430 AGGTACCATTTTCATTGTTTTGG + Intronic
1013030850 6:106331255-106331277 TGTTACTACAGTAATTGTTTTGG + Intergenic
1013088828 6:106880571-106880593 TGTTACTATTGTCATTGTTTGGG - Intergenic
1013172625 6:107650576-107650598 TGTTACTATTGTCATTGTTTTGG + Intronic
1013266481 6:108504489-108504511 TGTTACTGTTGTAATTGCTTTGG - Intronic
1013347406 6:109275065-109275087 TGTTACTATTGTAAATGTTTTGG - Intergenic
1013381866 6:109581032-109581054 TGTTACTATTATCATTGTTTGGG + Intronic
1013414681 6:109914008-109914030 TATTACTATTGTCATTGTTTTGG + Intergenic
1013699035 6:112740371-112740393 TGTTACCATTGTCATTGTTTTGG - Intergenic
1013729763 6:113151292-113151314 TATTACTATTGTAATTGTTTTGG - Intergenic
1013814461 6:114081169-114081191 TGTTACTACTGTAATTATTTCGG - Intronic
1013823748 6:114185967-114185989 TGTTACTACTGTAATTATTTTGG + Intronic
1013933098 6:115559100-115559122 TGATATTATTGTAACTGTTTTGG + Intergenic
1014076400 6:117240418-117240440 TGTTCCTATTGTAATTGTTTTGG + Intergenic
1014130378 6:117824566-117824588 TGTTACCATCGTAATTGTTTTGG + Intergenic
1014294214 6:119598510-119598532 TGTTGCTGTTGTAATTGTTTGGG - Intergenic
1014319594 6:119910435-119910457 TGTTACTATTGTAATTGTTCTGG + Intergenic
1014337669 6:120157745-120157767 TGTTACCATTGTAATTGCTTTGG - Intergenic
1014346087 6:120271189-120271211 TAGTATTATTTTCTTTGTTTGGG - Intergenic
1014378400 6:120706501-120706523 TGTTACTATGGTAATTGTTTTGG - Intergenic
1014417702 6:121204214-121204236 TGCTACTATTGTAGTTCTTTGGG - Intronic
1014419194 6:121219913-121219935 TGTTACTATTTTAATTATTTTGG + Intronic
1014478021 6:121899106-121899128 TATTACTATTGGAATTGTTTTGG + Intergenic
1014741385 6:125151491-125151513 TGTTACCATTGTAATTATTTTGG + Intronic
1014918272 6:127180870-127180892 TCCTACTATTCTCATTATTTGGG - Intronic
1014975564 6:127877658-127877680 TGCTACTATTGTTATTGTTTTGG - Intronic
1015259569 6:131220821-131220843 TGTTATTATCGTTATTGTTTTGG + Intronic
1015304172 6:131688146-131688168 TGTTACTATTGTAATTGTTTTGG + Intronic
1015337012 6:132050927-132050949 TGTTACCACTGTAATTGTTTTGG + Intergenic
1015418630 6:132980712-132980734 TGGTAAAATTGGAATTGTTTTGG + Intergenic
1015446163 6:133307631-133307653 TTGTACTATTGTCATTATATAGG - Intronic
1015746534 6:136515724-136515746 TGTCACTATTGTAATTGTTTTGG - Intronic
1015782665 6:136886017-136886039 TGCTACTTTTGTCATTATTAAGG + Intronic
1015939719 6:138435918-138435940 TATTACTATTGTAATTGTTTTGG + Intronic
1015943635 6:138476854-138476876 GGGTACAATGTTCATTGTTTAGG + Intronic
1016081596 6:139863901-139863923 TGTTTCTATTGTAATTGCTTTGG + Intergenic
1016199427 6:141389588-141389610 TGTTACTATCGTAATTGTTTTGG - Intergenic
1016222807 6:141696265-141696287 TGTTACTATTGTCACTGTTTTGG + Intergenic
1016344191 6:143093904-143093926 TCTTACTATTATAATTGTTTTGG - Intronic
1016490839 6:144600022-144600044 TGTTACTATTGTAATTGTTTTGG + Intronic
1016608906 6:145965552-145965574 TGTTACTATTGTAGTTTTTTGGG + Intergenic
1016616950 6:146061168-146061190 TGTCACTATTGTAATTGTTTTGG - Intronic
1016794050 6:148098879-148098901 TGTTACTATTGTAATTGTTTTGG + Intergenic
1016836429 6:148481729-148481751 TGTTAATATTGTAATTGTTTTGG - Intronic
1016850039 6:148609634-148609656 TGGTACAATGTTCATTGTTTAGG - Intergenic
1016867379 6:148780865-148780887 TGTTACTATTGTAATTGTTTGGG + Intronic
1017104178 6:150872549-150872571 TGTTACTGTTGTAATTGTGTTGG - Intronic
1017298290 6:152825680-152825702 TGTTACTATGGTAATTGTTTTGG - Intergenic
1017355173 6:153496642-153496664 TGTTCCTATTTTAATTGTTTTGG + Intergenic
1017461043 6:154650750-154650772 TTTTACTATTGTAATTATTTTGG - Intergenic
1017734659 6:157350378-157350400 TGTTACTATTGTAATTGTTTTGG + Intergenic
1018224140 6:161611531-161611553 TGTTACCATTGTGATTGTTTGGG + Intronic
1018491436 6:164297821-164297843 TGCTGCTTTTGTCATGGTTTTGG + Intergenic
1018691739 6:166350992-166351014 TGTTAGTACTGTAATTGTTTTGG - Intergenic
1019035634 6:169054912-169054934 TGTTAATGTTGTAATTGTTTTGG - Intergenic
1019263561 7:97720-97742 TGTTACTATTACAATTGTTTTGG - Intergenic
1019821951 7:3250762-3250784 TGTTACTATTGTAATTGTTTTGG + Intergenic
1019895708 7:3981216-3981238 TGTTACTATTGTAATTGTTTTGG + Intronic
1020523274 7:9222664-9222686 TGTTACTATTATAATTGTTTGGG + Intergenic
1020549017 7:9574352-9574374 TGTTACTTTTGTAATTGTTTTGG - Intergenic
1020570685 7:9857189-9857211 TGTTACTATTGTACTTGTTTTGG - Intergenic
1020597713 7:10229845-10229867 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1020626174 7:10582323-10582345 TGTTACTGTTGTAATGGTTTTGG + Intergenic
1020697960 7:11439488-11439510 TGTTACTATTGTAATTGTTTGGG + Intronic
1020727645 7:11835772-11835794 TGTTACTGTTGTAATTATTTTGG + Intergenic
1020765066 7:12309068-12309090 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1020802010 7:12743566-12743588 TGTTACTATTGTAATTGTTTTGG + Intergenic
1020833322 7:13118342-13118364 TGTTACTATTGTAATTGTGTTGG + Intergenic
1020939421 7:14511960-14511982 TGTTACTGTTGTCATTGTTTGGG - Intronic
1021267981 7:18548261-18548283 TGTTACTAGTGTAATTGTTTTGG - Intronic
1021282762 7:18740427-18740449 TAGTACTCTTGTAATTGTTTTGG + Intronic
1021285382 7:18775159-18775181 TAGTACTATTATAATTGTTTTGG - Intronic
1021314640 7:19132359-19132381 TGCTGCTCTTGTCATTGATTTGG + Intergenic
1021613982 7:22483669-22483691 TGTTACTACCGTAATTGTTTTGG + Intronic
1021678110 7:23101473-23101495 TGTTACTATTATAATTGTTTTGG + Intergenic
1022061951 7:26806030-26806052 AGTTACCATTGTAATTGTTTTGG + Intronic
1022144969 7:27528079-27528101 TGTTACTATTGAAACTGTTTTGG + Intronic
1022594534 7:31699844-31699866 TGTTACTATTGTAATTGTTTTGG + Intronic
1022958839 7:35405826-35405848 TGTTACTATTATAATTATTTTGG + Intergenic
1023026064 7:36050851-36050873 TGTTACTATTGTAACTGTTTTGG + Intergenic
1023099991 7:36707357-36707379 TGTTACTATTGTAATTGTTTCGG - Intronic
1023356017 7:39367878-39367900 TGTTACTATTGTAATTGTTTTGG + Intronic
1023397874 7:39768213-39768235 TGCTACTATTGTTATTTTTATGG - Intergenic
1023462118 7:40409585-40409607 CAATTCTATTGTCATTGTTTTGG + Intronic
1023645278 7:42306245-42306267 TGTTACTATTGTAATTGTTTTGG + Intergenic
1023667303 7:42537162-42537184 AGTTACTATTATAATTGTTTTGG + Intergenic
1023710273 7:42985321-42985343 TGTTACTATTGCAATTTTTTGGG - Intergenic
1023711685 7:43000194-43000216 TGTTACTATGGTAATTGTTTTGG - Intergenic
1023724351 7:43126820-43126842 TGTTACTAATGTAATTGCTTTGG + Intronic
1023778469 7:43633515-43633537 TGTTACTATTGTAATTGTTTTGG - Intronic
1024133289 7:46379367-46379389 TGTTATAATTGTAATTGTTTTGG + Intergenic
1024257949 7:47552587-47552609 TGTTACTATTGTAATTGTTTTGG + Intronic
1024549303 7:50548052-50548074 TGTTACTATTGTAATTGTTTTGG + Intronic
1024852597 7:53738250-53738272 TATTACTATTGTAATTGTTTTGG + Intergenic
1025134791 7:56402279-56402301 TGCTACTATTGTTATTTTTATGG + Intergenic
1025195905 7:56933139-56933161 TGTTACTATTGCCATTGTTTGGG + Intergenic
1025676043 7:63643797-63643819 TGTTACTATTGCCATTGTTTGGG - Intergenic
1025844319 7:65182555-65182577 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1025894647 7:65688889-65688911 TGTTACTGTTGTAATTGCTTTGG + Intergenic
1026590323 7:71689054-71689076 TGTTACTATTGTAATTATTCGGG + Intronic
1027005978 7:74693401-74693423 TGTTACTATTGTAATTGTACTGG + Intronic
1027289698 7:76692619-76692641 TATTACTATTGTAATTGTTTTGG + Intergenic
1027294158 7:76749800-76749822 TGCTACTATTGTAATTATTTTGG + Intergenic
1027296244 7:76774550-76774572 TGTTCCTATTGTGATTGTTTTGG - Intergenic
1027490305 7:78815693-78815715 TGTTACTATTGTAATTGTTTTGG + Intronic
1027512086 7:79095723-79095745 TGTTACTGTTGTAATTGTTTTGG - Intronic
1027573437 7:79901518-79901540 TGTTACTATTATAATTGTTTTGG + Intergenic
1027651728 7:80876600-80876622 TGGTAACATTCTCATTATTTGGG - Intronic
1027833114 7:83206153-83206175 TTGTATTTTTGACATTGTTTAGG - Intergenic
1027908873 7:84221751-84221773 TGTTACTATTATAATTGTTTTGG - Intronic
1027917657 7:84346676-84346698 TGTTACTATTGTAGTTGTTTTGG - Intronic
1028037719 7:86005402-86005424 TGTTACTATTGTAATTGTTTTGG - Intergenic
1028178320 7:87683647-87683669 TGTTACTATTGTAATAATTTTGG - Intronic
1028296672 7:89141167-89141189 TGTTACTATTGTAATTGTTTTGG - Intronic
1028366967 7:90043570-90043592 TGTTACTAGTGTAGTTGTTTGGG + Intergenic
1028408629 7:90503736-90503758 TGTTACTATTGTAATTGTTATGG - Intronic
1028695962 7:93712851-93712873 TGTTACTCTTGTAATTGTTTTGG + Intronic
1029049872 7:97674597-97674619 TGTTACTATTGAAGTTGTTTTGG + Intergenic
1029128398 7:98311583-98311605 TGGCGCTATTATCTTTGTTTTGG - Intronic
1029253929 7:99256139-99256161 TGGCACTATTATTATTGTTAAGG - Intergenic
1029378127 7:100194479-100194501 TGTTACTACTGTAACTGTTTTGG - Intronic
1029649758 7:101883320-101883342 TAGAACTATTGACATTGTATGGG + Intronic
1029883422 7:103840968-103840990 TGATTTTATTTTCATTGTTTTGG + Intronic
1029957514 7:104655063-104655085 TGGAACGATTGTCATTGCTTAGG - Intronic
1029980941 7:104878450-104878472 TGTTACTATTGTAATTGTTTTGG + Intronic
1030022525 7:105290073-105290095 TGATAATATGGTAATTGTTTTGG - Intronic
1030098747 7:105925524-105925546 TGTTACTATTGTAATTGTTTGGG - Intronic
1030172938 7:106622905-106622927 TGTCACTGTTGTAATTGTTTTGG - Intergenic
1030364600 7:108630971-108630993 AGTTACTATTGACATTGTGTTGG + Intergenic
1030387307 7:108879973-108879995 TGATACTATTGTAATTGTTCTGG + Intergenic
1030389915 7:108914890-108914912 TGGTTTTATTGTTTTTGTTTAGG + Intergenic
1030425983 7:109379032-109379054 TGTTACTAAGGTAATTGTTTTGG + Intergenic
1030479133 7:110080277-110080299 CATTACTATTGTCATTGTTCTGG - Intergenic
1030486570 7:110176046-110176068 GGGTACTATGTTCATTATTTGGG + Intergenic
1030505172 7:110412319-110412341 TGTAACTATTATAATTGTTTTGG - Intergenic
1030698302 7:112610549-112610571 TGTTACTGTTGTCATTGTTTAGG + Intergenic
1030723252 7:112894332-112894354 TGTTACTATTAAGATTGTTTAGG - Intronic
1030826983 7:114170193-114170215 TGTTACTATTATAATTGTTTGGG + Intronic
1030905974 7:115183224-115183246 TGTTACTATTATAATTGTTTGGG + Intergenic
1031057313 7:117006868-117006890 TGTTAGTATTGTAGTTGTTTTGG + Intronic
1031183700 7:118448830-118448852 TGGTACTATTTTAGTTGTTTTGG - Intergenic
1031234845 7:119161553-119161575 TGTTACTATTGTAATTGTTATGG - Intergenic
1031498726 7:122485004-122485026 TGATATTATTGTAATTGTTTTGG + Intronic
1031815301 7:126426260-126426282 TGTTACTACTGTAATTGTTTTGG - Intergenic
1031827281 7:126581818-126581840 TGTTACTATTGTAATTGTTTTGG + Intronic
1031851578 7:126870685-126870707 TGTTACTGTTGTAATTGTTTGGG - Intronic
1031878363 7:127167628-127167650 TGGAATTATTATAATTGTTTTGG + Intronic
1031921602 7:127605937-127605959 TGTTACTATTGTAATTGTTTTGG - Intergenic
1032180898 7:129676593-129676615 TGTTACTATTTTAATTGTTTTGG - Intronic
1032558632 7:132864398-132864420 TGTTACTATTGTAATTGTTTTGG - Intronic
1032622425 7:133549519-133549541 TGTTACTATTGTAATGGTTTGGG - Intronic
1032769060 7:135029989-135030011 TGTTACTGTTGTAATTGTTTTGG - Intronic
1032778931 7:135146322-135146344 TGTTACTATTGTGATTGTTTTGG - Intronic
1032861746 7:135886345-135886367 TGTTACTATTGTAATTGTTTTGG + Intergenic
1032983489 7:137311764-137311786 TGTTACTGTTGTAATTGTTTTGG - Intronic
1033107576 7:138542457-138542479 TGTTAATATTGTGACTGTTTTGG - Intronic
1033386520 7:140881909-140881931 TGTTACTATTGTAATTGTTTTGG - Intronic
1033388414 7:140902262-140902284 TGTTACTATTGTAATTCTTTTGG + Intronic
1033673502 7:143515180-143515202 TGCTGCTATTGTTATTGTTCCGG + Intergenic
1033795273 7:144838265-144838287 TGTTACTCTTGTCATTGTTTTGG + Intergenic
1033845944 7:145432257-145432279 TGTTACCATTGTAATTGCTTTGG - Intergenic
1034022169 7:147656624-147656646 CGTTACTATTGTCATTGTTTTGG - Intronic
1034028155 7:147730478-147730500 TAATACTATTATAATTGTTTTGG + Intronic
1034361626 7:150504700-150504722 TGTCCCTATTGTAATTGTTTTGG + Intergenic
1034568775 7:151937801-151937823 TGTTACTACTGTAGTTGTTTTGG + Intergenic
1034583442 7:152066828-152066850 TGTTACTCCTGTAATTGTTTTGG - Intronic
1034611678 7:152376108-152376130 TGTTACTATTGTAATTGTTTTGG + Intronic
1034727504 7:153351696-153351718 TGTTACTATTGTAGTTGTTTTGG + Intergenic
1034873228 7:154702109-154702131 TGTTACTGATGTAATTGTTTTGG + Intronic
1035143259 7:156785916-156785938 AGGTACTATTGTTAGTGTTAGGG - Intronic
1035144393 7:156799449-156799471 TGTTACTATGTTAATTGTTTGGG + Intronic
1035387072 7:158480284-158480306 TGGTGTTACTGTCATTGTTTTGG + Intronic
1035480056 7:159175040-159175062 TGTTACTATTGTAATGGTTTGGG - Intergenic
1035943788 8:3935601-3935623 TGTAACTATTGTAATTGTTTGGG + Intronic
1036021076 8:4847339-4847361 TGATGTTAGTGTCATTGTTTAGG - Intronic
1036198030 8:6738448-6738470 TGTTACTATTGTAATTGTTTGGG - Intronic
1037019707 8:13954898-13954920 TGTTACTATTGTAGTTCTTTTGG - Intergenic
1037145935 8:15572882-15572904 TGTCACTTTTGTGATTGTTTTGG - Intronic
1037214113 8:16427505-16427527 TGTTATTATTGTTATTGTTTTGG + Intronic
1037218557 8:16488053-16488075 TGCTACTGTTGTAATTGTTTTGG - Intronic
1037303705 8:17482318-17482340 TGTTACTCTTGTAGTTGTTTTGG + Intergenic
1037327838 8:17711994-17712016 TGTTACTGTTGTGATTGTTTTGG - Intronic
1037417130 8:18663976-18663998 TGTTACTACTGTAATTGTTTTGG + Intronic
1037435638 8:18860261-18860283 TGTTACTATTGTCATTGTTTTGG - Intronic
1037447698 8:18983683-18983705 TGTTACTCTTGTAATTGCTTTGG - Intronic
1038297596 8:26309852-26309874 TATTACTATTGTAATTGTTTTGG - Intronic
1038392915 8:27221668-27221690 TGTCACTATTGTAATTGTTTAGG - Intergenic
1038526889 8:28282435-28282457 TGTTACTATTGTAATTGTTTTGG + Intergenic
1038682220 8:29679412-29679434 TGGTACTATTCTCCTTGTCCAGG - Intergenic
1038904308 8:31881314-31881336 TGTTAATATTGTAATTGTTTGGG + Intronic
1039053763 8:33517478-33517500 TGGTAATATTAATATTGTTTAGG + Intergenic
1039076806 8:33697881-33697903 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1039556166 8:38476731-38476753 TTTCATTATTGTCATTGTTTTGG + Intergenic
1039603411 8:38861348-38861370 CGTTACTATTGTCTTTGTTTTGG + Intergenic
1039625333 8:39044546-39044568 AGGTACAATGTTCATTGTTTGGG - Intronic
1039658542 8:39436908-39436930 TGGGATTTTTGTCATTGGTTCGG - Intergenic
1039972897 8:42335414-42335436 TGCCACTTTTCTCATTGTTTAGG - Intergenic
1039983839 8:42430852-42430874 TGTTACTATTATAATTGTTTTGG + Intronic
1040068115 8:43165254-43165276 TGCTCCTACTGTAATTGTTTTGG + Intronic
1040452095 8:47558195-47558217 TGGTACTATGTTCACTGTTGAGG + Intronic
1040737291 8:50523648-50523670 TGCTACTATTGTAATTCTTTTGG - Intronic
1040754029 8:50748753-50748775 TGTTATTATTGTAATTATTTTGG + Intronic
1040759269 8:50818749-50818771 TGGTACTTTTTTCATTCTTGGGG + Intergenic
1040841058 8:51785621-51785643 TGTTATCATTGTAATTGTTTGGG + Intronic
1041432292 8:57796285-57796307 TGTTACTATTGTAATTGCTTTGG + Intergenic
1041450870 8:58005336-58005358 TGTTACCATTGTAATTGTTTGGG - Intronic
1041476017 8:58266792-58266814 TGTTACCATTGTAATTGTTTTGG - Intergenic
1041540354 8:58977827-58977849 TGTTATTAGTGTAATTGTTTTGG - Intronic
1041602840 8:59742004-59742026 TGTTACTATTCTCATTATTAAGG + Intergenic
1041622056 8:59982970-59982992 TGTTACTATTATAATTGTTTTGG - Intergenic
1041741345 8:61160406-61160428 TGGTAGAATTGTTTTTGTTTCGG - Intronic
1041770058 8:61463705-61463727 TGTTACTATTGTAATTGTTTTGG - Intronic
1041926267 8:63240209-63240231 TGTTACTATTGTAATCGTTTTGG - Intergenic
1042045555 8:64647245-64647267 TGTTACTGTTGTAATTGTTGTGG - Intronic
1042140420 8:65673325-65673347 TGTTACTACTTTAATTGTTTTGG - Intronic
1042154196 8:65824245-65824267 TGATACTATTGTAATTGTCTGGG + Intronic
1042288015 8:67136075-67136097 TGTTACTATTATAATTGTTTTGG - Intronic
1042299420 8:67260499-67260521 TGTTGCTATTGTAATTGTTTTGG + Intronic
1042419436 8:68568138-68568160 TGTTCCTATTGTAATTGCTTTGG - Intronic
1042547995 8:69967953-69967975 TGTTACTATTGTAATTGTTTGGG + Intergenic
1042626164 8:70759631-70759653 TTTGACTATTGTCATTGTGTAGG + Intronic
1042851792 8:73224132-73224154 TGTTACTATTGTAATTGTTTTGG - Intergenic
1043077662 8:75721997-75722019 TGTTAGTAATGTCATTATTTTGG - Intergenic
1043083839 8:75801953-75801975 TGCCACTATTGTAATTGTTTTGG - Intergenic
1043098996 8:76016088-76016110 TGTTATTATTGTAATTATTTTGG + Intergenic
1043204183 8:77415457-77415479 TGTTACTATTGTAATTGTTTGGG + Intergenic
1043420806 8:80096670-80096692 TGTTACTATTGTAATTGTTTTGG + Intronic
1043722490 8:83563128-83563150 TGTTACTATTGTAACTATTTTGG - Intergenic
1044044093 8:87408820-87408842 TGTTACTATTGTAATTGTTTTGG + Intronic
1044223127 8:89693015-89693037 TACTACTATTGTAATTGTTTTGG + Intergenic
1044259627 8:90102477-90102499 TGTTACTATCATAATTGTTTGGG - Intergenic
1044287836 8:90430239-90430261 TGTGACTCTTGTAATTGTTTTGG + Intergenic
1044668965 8:94659345-94659367 TGTTACTGGTGTAATTGTTTTGG + Intronic
1044807726 8:96025369-96025391 TGTTACTATTTTAATTGTTTGGG + Intergenic
1044889522 8:96818326-96818348 TATTGCTATTGTAATTGTTTTGG - Intronic
1045073181 8:98532421-98532443 TGCTACTATTGTAATTGTTTTGG - Intronic
1045355449 8:101384472-101384494 TGTTACTATCATAATTGTTTGGG - Intergenic
1045381100 8:101627375-101627397 TGTTACTATTGTAATTGTTTTGG + Intronic
1045728633 8:105206267-105206289 TGTTACCATTGTAATTGTTTTGG - Intronic
1045967039 8:108036873-108036895 TGTTACTTTTGTAATTGTTTTGG + Intronic
1046040684 8:108900035-108900057 TATTACTATTGCCATTGTTTTGG + Intergenic
1046069524 8:109233400-109233422 TGTTTCTATTCTAATTGTTTTGG - Intergenic
1046316803 8:112513497-112513519 TGTTACTATTGTAATTGTTTTGG - Intronic
1046545525 8:115644961-115644983 TGTCACTATTGTTATTGTTTTGG - Intronic
1046571764 8:115975038-115975060 TGTTACTATTGCAATTGTTTTGG - Intergenic
1046571793 8:115975523-115975545 TGTTACTATTGCAATTGTTTTGG + Intergenic
1046743741 8:117855444-117855466 TGTTACTACTGTAATTGTTTTGG + Intronic
1046787490 8:118283843-118283865 AGGTTCTATTCTCATTATTTAGG + Intronic
1046801870 8:118437569-118437591 AGGTACTATTTTCTTTATTTTGG + Intronic
1046927690 8:119809806-119809828 TATTACAATTGTAATTGTTTTGG - Intronic
1047034523 8:120922502-120922524 TGTTACTATTATAACTGTTTGGG - Intergenic
1047178199 8:122562027-122562049 TGTTACTATTATAATTGTTTGGG - Intergenic
1047400635 8:124543651-124543673 TGTTACTATTGTCATTGTTTTGG + Intronic
1047576966 8:126166741-126166763 TGCTATTATTGTCATTGTTTTGG - Intergenic
1047630759 8:126705323-126705345 TGTCACTATTGTAATTATTTGGG - Intergenic
1047703612 8:127474797-127474819 TATTACTATTGTAATTGTTTTGG + Intergenic
1047827861 8:128597368-128597390 TGTTACTATTGTAATTATTTTGG + Intergenic
1048077573 8:131089519-131089541 TGTTACTACTGTAATTTTTTTGG + Intergenic
1048079466 8:131109732-131109754 TGTTACTATTGTAATTGTTTTGG - Intergenic
1048129320 8:131676408-131676430 TGTTACTATTGTAATTGTTTTGG - Intergenic
1048515319 8:135103364-135103386 GGGTACTATGTTCATTCTTTGGG - Intergenic
1048824350 8:138409352-138409374 TGTTACTATTGTAATTGTTTTGG - Intronic
1048975450 8:139670226-139670248 CGTTACTATTGTAATTGTCTGGG - Intronic
1049122578 8:140752577-140752599 TGGTACTATTCTAAGTGCTTGGG + Intronic
1049145096 8:140994652-140994674 TGTTACTACTGTAGTTGTTTTGG + Intronic
1049314172 8:141951162-141951184 TGTTACTATTGCAATTGTTTAGG + Intergenic
1050321435 9:4456873-4456895 TGTTAGTATTGCAATTGTTTTGG - Intergenic
1050349604 9:4728032-4728054 TGTTACTATTATAATTGTTTTGG - Intronic
1050437324 9:5624888-5624910 TGTAACTATTGTAATTGTTTTGG - Intergenic
1050647650 9:7738737-7738759 TGTTACTGTTGTAGTTGTTTTGG - Intergenic
1050790375 9:9461218-9461240 TGGTACTATGTTCACTATTTAGG + Intronic
1050792572 9:9492903-9492925 TATTACTATTGTAATTGTTCTGG + Intronic
1050805073 9:9666520-9666542 TGTAAGTTTTGTCATTGTTTTGG - Intronic
1050867361 9:10519781-10519803 TGTTACTATTGTCATTGTTTCGG + Intronic
1051085042 9:13338544-13338566 TGTTACTATTGTAATTGTTTTGG - Intergenic
1051114693 9:13681269-13681291 TGTTACTCTAGTAATTGTTTTGG - Intergenic
1051123742 9:13780282-13780304 TGTAACTATTGTAATTGTTTGGG + Intergenic
1051147210 9:14040108-14040130 TGTTACTATTGTAATTCTTTTGG - Intergenic
1051201542 9:14631855-14631877 TGTTACTATTGTAATTATTTTGG - Intronic
1051298234 9:15618995-15619017 TACTGCTATTGTAATTGTTTTGG + Intronic
1051305468 9:15703893-15703915 TGTTATTATTGTAATTGTTTTGG - Intronic
1051508594 9:17852198-17852220 AGGTGCTATTATCATAGTTTTGG + Intergenic
1051601705 9:18881547-18881569 TGTTACTATTGTAATTGTTTTGG - Intronic
1051753565 9:20370290-20370312 TGCTACTATTGTAATTGCTTTGG + Intronic
1051767781 9:20543420-20543442 AGATACTATTGTAACTGTTTTGG - Intronic
1051853018 9:21530767-21530789 TGTTACTATTGCAGTTGTTTTGG - Intergenic
1051883058 9:21859811-21859833 TGGTACTATTGTCAGAGTTTTGG - Intronic
1051967949 9:22851907-22851929 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1052087412 9:24284441-24284463 TGCTACTATTAACATTCTTTTGG + Intergenic
1052371367 9:27668671-27668693 TGTTATTATTGTAACTGTTTTGG - Intergenic
1052423770 9:28277267-28277289 TGTTACTATTATAATTGTTTTGG + Intronic
1053132521 9:35624853-35624875 TGTTAATATTGTCATTGTTTTGG + Intronic
1053172497 9:35899487-35899509 TGTTACTACTGTAATTGTTTCGG - Intergenic
1053421392 9:37981905-37981927 TGTTACTGTTGTAATTGTTTTGG - Intronic
1053465637 9:38306188-38306210 TGTTTTTATTGTAATTGTTTTGG - Intergenic
1053575066 9:39351289-39351311 TATTACTATTGTCATTGTTTTGG + Intergenic
1053578979 9:39383361-39383383 TGTTACTATTGTAATTGTTTTGG - Intergenic
1053620657 9:39810884-39810906 TATTACTATTGTCATTGTTTTGG - Intergenic
1053626052 9:39873051-39873073 TATTACTATTGTCATTGTTTTGG + Intergenic
1053639726 9:40059421-40059443 TGTTACTATTGTAATTGTTTTGG - Intergenic
1053766407 9:41406014-41406036 TGTTACTATTGTAATTGTTTTGG + Intergenic
1053839572 9:42179224-42179246 TATTACTATTGTCATTGTTTTGG + Intergenic
1053843491 9:42211436-42211458 TGTTACTATTGTAATTGTTTTGG - Intergenic
1053878827 9:42570168-42570190 TATTACTATTGTCATTGTTTTGG - Intergenic
1053893843 9:42724197-42724219 TATTACTATTGTCATTGTTTTGG + Intergenic
1054096631 9:60909972-60909994 TATTACTATTGTCATTGTTTTGG + Intergenic
1054100562 9:60942165-60942187 TGTTACTATTGTAATTGTTTTGG - Intergenic
1054118034 9:61185598-61185620 TATTACTATTGTCATTGTTTTGG + Intergenic
1054121959 9:61217790-61217812 TGTTACTATTGTAACTGTTTTGG - Intergenic
1054217836 9:62377650-62377672 TATTACTATTGTCATTGTTTTGG - Intergenic
1054232862 9:62531527-62531549 TATTACTATTGTCATTGTTTTGG + Intergenic
1054263506 9:62896560-62896582 TATTACTATTGTCATTGTTTTGG + Intergenic
1054320475 9:63655760-63655782 TGTTACTATTGTAATTGTTTTGG - Intergenic
1054545024 9:66317194-66317216 TGTTACTATTGTAATTGTTTTGG + Intergenic
1054585784 9:66964721-66964743 TGTTACTATTGTAATTGTTTTGG + Intergenic
1054589721 9:66996966-66996988 TATTACTATTGTCATTGTTTTGG - Intergenic
1054994492 9:71370012-71370034 TGTTACTATTGTAATGGTTTTGG + Intronic
1055189952 9:73506496-73506518 TGTTGCTATTGTAATTGTTTGGG + Intergenic
1055232326 9:74080509-74080531 TGTTACTATTGAAATTGCTTTGG - Intergenic
1055297114 9:74845060-74845082 TGTCACTATTGTAATTGTTTTGG - Intronic
1055377227 9:75662282-75662304 TGTTACTACTGTAATTGTTTTGG + Intergenic
1055534367 9:77222724-77222746 TGTTACTGTTGTAACTGTTTTGG + Intronic
1055661439 9:78507697-78507719 TGCTATTATTTTCATTGTTCGGG + Intergenic
1055807408 9:80111984-80112006 TGTTCCTATTGTAATTATTTTGG - Intergenic
1056140376 9:83672615-83672637 TGTTACTTTAGTAATTGTTTTGG - Intronic
1056181733 9:84090304-84090326 TGTTACTATTGTAATTGGTTTGG - Intergenic
1056227198 9:84507288-84507310 TATTACTATTGTAATTGTTTTGG + Intergenic
1056979233 9:91293013-91293035 TGTTACTACTGTAATTATTTTGG + Intronic
1057287381 9:93768985-93769007 ATGTACTATTATAATTGTTTTGG - Intergenic
1057370792 9:94471186-94471208 TGTTACTACTGTACTTGTTTTGG - Intergenic
1057823717 9:98355184-98355206 TGTTACTATTGTAATTGTTTTGG - Intronic
1058196358 9:101981698-101981720 TGTTACTGTTGTAATTGTTTTGG + Intergenic
1058260870 9:102829689-102829711 TGCTACTATTGTAATTGTTTTGG + Intergenic
1058285904 9:103177640-103177662 TTTTACTATTGTCATTGTTTTGG - Intergenic
1058340816 9:103893947-103893969 TAGTAGTATTATCATGGTTTAGG - Intergenic
1058348788 9:103996969-103996991 TGTTACTATTGTAATTATTTGGG - Intergenic
1058468079 9:105248336-105248358 TGGTATTATTTTCATTTTCTTGG + Intronic
1058920093 9:109605568-109605590 TGTTACTATTATAATTGTTTTGG + Intergenic
1058928033 9:109688055-109688077 TGTTACCATCGTAATTGTTTCGG - Intronic
1059047627 9:110886667-110886689 TGGTACCATTGTTTTTGATTGGG - Intronic
1059134069 9:111786700-111786722 AGTTACCATTGTAATTGTTTGGG + Intronic
1059156675 9:111995526-111995548 TGTTACTATTGTCATTGTTTTGG - Intergenic
1059264746 9:113016596-113016618 TGTTATTATTGTGATTGTTTTGG + Intergenic
1059558887 9:115311695-115311717 TGTCAATATTGTAATTGTTTTGG + Intronic
1059572520 9:115454885-115454907 TGTTACTATTGTAATTGTTTGGG - Intergenic
1059833579 9:118126007-118126029 TGTTACTATTGTAATTGTTTTGG + Intergenic
1059843522 9:118245100-118245122 TTGTACTAGTGTTTTTGTTTAGG + Intergenic
1059852385 9:118358122-118358144 TGTTACTAAGGTCATTGCTTAGG - Intergenic
1059917474 9:119119508-119119530 TGTTACTATTGTAATTGTTTTGG + Intergenic
1059936370 9:119315383-119315405 TGTTATTATTGTAATTATTTGGG + Intronic
1060460421 9:123848400-123848422 TGTTGCTGTTGTAATTGTTTTGG + Intronic
1061155840 9:128860914-128860936 TATTACTATTGTGCTTGTTTTGG - Intronic
1061784309 9:133016897-133016919 TGTTATTATGGTAATTGTTTTGG + Intergenic
1202787544 9_KI270719v1_random:42796-42818 TGTTACTATTGTAATTGTTTTGG - Intergenic
1203750096 Un_GL000218v1:70829-70851 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1203483884 Un_GL000224v1:33532-33554 TGGTACTGTTGTCATTGTTTTGG - Intergenic
1203363646 Un_KI270442v1:238784-238806 TGGTGCTGTCGTCATTGTTTTGG - Intergenic
1203708813 Un_KI270742v1:77035-77057 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1203542280 Un_KI270743v1:100545-100567 TGCTACTGTTGTCATTGTTTTGG - Intergenic
1185890550 X:3817938-3817960 TGGTATTATGTTCACTGTTTGGG - Intronic
1185895533 X:3855088-3855110 TGGTATTATGTTCACTGTTTAGG - Intergenic
1185900652 X:3893512-3893534 TGGTATTATGTTCACTGTTTAGG - Intergenic
1185905768 X:3931943-3931965 TGGTATTATGTTCACTGTTTAGG - Intergenic
1186025670 X:5308195-5308217 TGGCAATATTTTCAGTGTTTGGG - Intergenic
1186256025 X:7720791-7720813 TATTACTATTGTAATTGTGTTGG - Intergenic
1186304098 X:8235455-8235477 TGTTACTATTATAATTGTTTTGG - Intergenic
1186706755 X:12147891-12147913 TGTTACTATTGCAATTGTTTTGG + Intronic
1186849220 X:13563741-13563763 TGTTACTATTGTAATTGTTTTGG - Intergenic
1186942354 X:14523793-14523815 TGTTACTACTGTAATTGTTTGGG - Intergenic
1186994778 X:15108380-15108402 AGTTACTATTGTAAATGTTTTGG + Intergenic
1187110871 X:16298669-16298691 TGTTACTATTGTAGCTGTTTTGG - Intergenic
1187250605 X:17594636-17594658 CTGTCCTATTGTCTTTGTTTAGG + Intronic
1187524389 X:20040734-20040756 TGTTACTGTTATAATTGTTTTGG - Intronic
1187614072 X:20973923-20973945 TGATACTACTCTCATAGTTTGGG + Intergenic
1187662964 X:21571178-21571200 TGTTACTACTGTAATTATTTTGG - Intronic
1187760112 X:22573837-22573859 TGTTACTATTGTAATTGTTTTGG + Intergenic
1187800394 X:23055932-23055954 TGTTACTACTGTAATTGTTTTGG + Intergenic
1187890344 X:23928670-23928692 TGTTACTATTGTAATTGTTTTGG + Intronic
1187908818 X:24091614-24091636 TGTCACTACTGTAATTGTTTTGG - Intergenic
1188093024 X:25987086-25987108 TGTTACTATTGCAATTGTTCTGG + Intergenic
1188138919 X:26524835-26524857 TGTTTCTATTGTAATTGTTTTGG + Intergenic
1188159530 X:26783252-26783274 GGCTGCTATTGTCTTTGTTTGGG - Intergenic
1188231021 X:27663504-27663526 TGTTACTATTGTAATTGCTTTGG + Intronic
1188291455 X:28393722-28393744 TGCTACTATTGTAATTGTTTTGG - Intergenic
1188425139 X:30037554-30037576 TTTTACTATCGTAATTGTTTTGG + Intergenic
1188432645 X:30122480-30122502 CGGTACTATTGGAATTGTTTTGG + Intergenic
1188448207 X:30279876-30279898 TGCTACTATTAAAATTGTTTTGG + Intergenic
1188456158 X:30368742-30368764 TGTTACTATTGTAATTGTTTTGG - Intergenic
1188540543 X:31245709-31245731 TGTTACTACTGAAATTGTTTTGG + Intronic
1188601706 X:31974313-31974335 AGGTACTATGCTCACTGTTTGGG + Intronic
1188705408 X:33322477-33322499 AGTTACTATTGTCATTTTTGGGG - Intronic
1188732640 X:33670103-33670125 TTTTACTATTGTAATTGTTTTGG + Intergenic
1188822169 X:34788858-34788880 TGTTACTATTGTAATTGTTTTGG - Intergenic
1189072426 X:37877902-37877924 TGGTACTATTGTCATTGTTTAGG + Intronic
1189708666 X:43785865-43785887 TGTTACTATTGTAATTGTTTAGG - Intronic
1189752296 X:44234750-44234772 TGGTACCACTGTCATTGCTGAGG - Intronic
1189788004 X:44576941-44576963 TGTTACTATTGTAATTGTTTTGG + Intergenic
1189827766 X:44937522-44937544 TGTTACTGTTGTAATTGTTTTGG + Intronic
1189830263 X:44965659-44965681 TGTTACTACTGTAATTGTTTTGG - Intronic
1189942598 X:46141064-46141086 TGTTACTATTGTAATTGTTTTGG + Intergenic
1190460829 X:50672159-50672181 TGGTACTATTGTAATTGTTTGGG - Intronic
1190498120 X:51047061-51047083 TGGGGCTATTGTCAGTGTATGGG - Intergenic
1190508294 X:51150809-51150831 TGGGACTATTGGCAGTGTATGGG + Intergenic
1191604190 X:63043630-63043652 TTGTTCTATTGTCATAGTCTAGG + Intergenic
1191798277 X:65047002-65047024 TGTTACTATTGTAATTGTTTGGG - Intergenic
1191959562 X:66685393-66685415 TGCACGTATTGTCATTGTTTGGG + Intergenic
1192028748 X:67486008-67486030 TGTTACCATTGCAATTGTTTTGG - Intergenic
1192078716 X:68026370-68026392 TGTTACTATTATAATTCTTTTGG + Intergenic
1192301933 X:69913994-69914016 TGTTACTAGGGTAATTGTTTTGG - Intronic
1192667602 X:73104001-73104023 TGTTACTATTATAATTGTTTTGG + Intergenic
1192720329 X:73689317-73689339 TATTACTATCGTAATTGTTTTGG - Intergenic
1193020149 X:76782924-76782946 TGTTACTATTGTAATTGCTTGGG + Intergenic
1193248829 X:79264172-79264194 AGGTACTATTATCCTTATTTAGG - Intergenic
1193331523 X:80240160-80240182 CGTTACTATTATAATTGTTTTGG + Intergenic
1193405189 X:81092114-81092136 TGTCACTATTGTCATTCTGTTGG - Intergenic
1193615221 X:83679340-83679362 TGTTACTATTGTAATTGTTTTGG - Intergenic
1193652206 X:84150668-84150690 TGTTAGTGTTGTCATTGTTTCGG - Intronic
1193678040 X:84481812-84481834 GGGTACTATGTTCACTGTTTGGG - Intronic
1193905998 X:87244871-87244893 TGTTGCTATTCTAATTGTTTTGG + Intergenic
1194100512 X:89697449-89697471 TATTACTATTGTAATTATTTTGG - Intergenic
1194120784 X:89961147-89961169 TGTTGCTATTGTAATTGTTTTGG + Intergenic
1194141246 X:90213023-90213045 TGTTACTATTGTAACTGTTTTGG - Intergenic
1194286476 X:92017142-92017164 TGTTACTATTATAATTATTTGGG - Intronic
1194557964 X:95385824-95385846 TGGTAGTAGTTTCATGGTTTGGG + Intergenic
1194601998 X:95933389-95933411 TGCTGCTATTGTCATTATATGGG - Intergenic
1194875308 X:99179636-99179658 TGTCATTATTGTCATTGTTTTGG - Intergenic
1194940207 X:100000077-100000099 TGTTACTATTGTAATTGTTTTGG + Intergenic
1195231188 X:102849952-102849974 TTTTACTGTTGTAATTGTTTCGG - Intergenic
1195510439 X:105709989-105710011 TGTTATTGTTGTTATTGTTTTGG - Intronic
1195690919 X:107624520-107624542 TGCTACTATTGTGATCATTTTGG - Intergenic
1195987934 X:110651465-110651487 TGTTACTATTGTAATTGTTTTGG - Intergenic
1196260377 X:113572267-113572289 TGTTGTTATTGTAATTGTTTTGG - Intergenic
1196333390 X:114499071-114499093 TGTTACTATTCTAATTCTTTTGG - Intergenic
1196384451 X:115133669-115133691 TGTTACTATTGTAATTTTTGAGG + Intronic
1196472585 X:116045519-116045541 TGGTACAATTTTCATTATTCAGG + Intergenic
1196547944 X:116986608-116986630 TTTTACAATTGTAATTGTTTTGG - Intergenic
1196721348 X:118857342-118857364 TGTTAACATTGTAATTGTTTTGG + Intergenic
1196738740 X:119005390-119005412 TGGTACTATTTTAATTGCTTGGG - Intronic
1196856281 X:119988359-119988381 TGCTATTATTGTCATTTTATAGG - Intergenic
1196971631 X:121115904-121115926 TGTTACTGTTGTAATTGTTTTGG - Intergenic
1197505390 X:127296329-127296351 TGTTACTATCGTTATTGCTTTGG - Intergenic
1197597474 X:128483145-128483167 TCTTACTATTTTAATTGTTTTGG - Intergenic
1197949372 X:131877585-131877607 TGTTACTATTATAATTGTTTTGG + Intergenic
1198281427 X:135146628-135146650 TGTTACTATTGTCATTCTGTTGG - Intergenic
1198289532 X:135225888-135225910 TGTTACTATTGTCATTCTGTTGG + Intergenic
1198323155 X:135539906-135539928 TGTTACTATTGTAATTATTTTGG - Intronic
1198510331 X:137344020-137344042 TGGTAGAATTGTCATTGGGTTGG - Intergenic
1198542887 X:137659048-137659070 TGTTACTATTGTAATTGTTTTGG + Intergenic
1198621369 X:138514370-138514392 TGCTACTATTTTAAGTGTTTAGG - Intergenic
1198634600 X:138681904-138681926 TGTTACTCTTATAATTGTTTTGG - Intronic
1198690368 X:139276864-139276886 TGTTACTATTGTAATTGTTTTGG - Intergenic
1198765310 X:140074251-140074273 TTGTACAAATGTCATTGTCTTGG + Intergenic
1198771669 X:140137453-140137475 TTGTACAAATGTCATTGTCTTGG + Intergenic
1198826666 X:140705404-140705426 TGTTACTATTGTAATTATTTGGG - Intergenic
1198883766 X:141310633-141310655 TGTTACTATTGTAATTGTTTTGG - Intergenic
1198970689 X:142275731-142275753 TGTTACACTTGTAATTGTTTTGG - Intergenic
1199281389 X:146004179-146004201 TGTTACTATTGTAATTGTTTTGG + Intergenic
1199359234 X:146898315-146898337 TTTTACTATTGTCATTACTTGGG + Intergenic
1199409318 X:147502157-147502179 TGTCACTATTGTAATTGTTTGGG + Intergenic
1199577588 X:149328291-149328313 TGTTACTATTGTAACTGTTTTGG + Intergenic
1199916858 X:152352011-152352033 TGTTATTATTTTAATTGTTTTGG - Intronic
1200367330 X:155680888-155680910 TGTTACTATTGTAATTATTTGGG + Intergenic
1200453464 Y:3358510-3358532 TATTACTATTGTAATTATTTTGG - Intergenic
1200473649 Y:3618652-3618674 TGTTGCTATTGTAATTGTTTTGG + Intergenic
1200487000 Y:3782125-3782147 TGTTACTATTGTAACTGTTTTGG - Intergenic
1200604020 Y:5241693-5241715 TGTTACTATTATAATTATTTGGG - Intronic
1201074671 Y:10178055-10178077 TGGTCCTGTCATCATTGTTTTGG + Intergenic
1201163749 Y:11188468-11188490 TGCTACTGTTGTCATTGTTTTGG + Intergenic
1201711965 Y:17002275-17002297 GGGTACAATGTTCATTGTTTGGG + Intergenic
1201894716 Y:18981311-18981333 TGGTATTATGTTCACTGTTTGGG + Intergenic
1202126002 Y:21569386-21569408 TGGTCCTTTTCTCATTGTGTGGG + Intergenic
1202251724 Y:22880037-22880059 AGGTACAATTGTCATTATTAGGG + Intergenic
1202404712 Y:24513786-24513808 AGGTACAATTGTCATTATTAGGG + Intergenic
1202466067 Y:25156296-25156318 AGGTACAATTGTCATTATTAGGG - Intergenic
1202594125 Y:26519399-26519421 TATTACTATTGTAGTTGTTTTGG + Intergenic