ID: 993600302

View in Genome Browser
Species Human (GRCh38)
Location 5:89914934-89914956
Sequence TGTGCAATGTTTAAAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993600302_993600311 21 Left 993600302 5:89914934-89914956 CCTGCCACTTTAAACATTGCACA No data
Right 993600311 5:89914978-89915000 ACCAAAACTAACCTTTCCACTGG No data
993600302_993600313 22 Left 993600302 5:89914934-89914956 CCTGCCACTTTAAACATTGCACA No data
Right 993600313 5:89914979-89915001 CCAAAACTAACCTTTCCACTGGG No data
993600302_993600305 -8 Left 993600302 5:89914934-89914956 CCTGCCACTTTAAACATTGCACA No data
Right 993600305 5:89914949-89914971 ATTGCACAGTGAAACTCCCTGGG No data
993600302_993600304 -9 Left 993600302 5:89914934-89914956 CCTGCCACTTTAAACATTGCACA No data
Right 993600304 5:89914948-89914970 CATTGCACAGTGAAACTCCCTGG No data
993600302_993600306 -7 Left 993600302 5:89914934-89914956 CCTGCCACTTTAAACATTGCACA No data
Right 993600306 5:89914950-89914972 TTGCACAGTGAAACTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993600302 Original CRISPR TGTGCAATGTTTAAAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr