ID: 993607555

View in Genome Browser
Species Human (GRCh38)
Location 5:90012359-90012381
Sequence CTTTTTAAATTTAAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993607555_993607557 24 Left 993607555 5:90012359-90012381 CCATAGATCTTAAATTTAAAAAG No data
Right 993607557 5:90012406-90012428 AGATATACACATATACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993607555 Original CRISPR CTTTTTAAATTTAAGATCTA TGG (reversed) Intergenic
No off target data available for this crispr