ID: 993617238

View in Genome Browser
Species Human (GRCh38)
Location 5:90128530-90128552
Sequence CATTTACTGGGCATCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993617238_993617245 13 Left 993617238 5:90128530-90128552 CCACTGGAGATGCCCAGTAAATG No data
Right 993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG No data
993617238_993617246 28 Left 993617238 5:90128530-90128552 CCACTGGAGATGCCCAGTAAATG No data
Right 993617246 5:90128581-90128603 AGAGCAGGCCTAGCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993617238 Original CRISPR CATTTACTGGGCATCTCCAG TGG (reversed) Intergenic
No off target data available for this crispr