ID: 993617240

View in Genome Browser
Species Human (GRCh38)
Location 5:90128543-90128565
Sequence GTGGGGAAATGCTCATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993617240_993617245 0 Left 993617240 5:90128543-90128565 CCAGTAAATGAGCATTTCCCCAC No data
Right 993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG No data
993617240_993617246 15 Left 993617240 5:90128543-90128565 CCAGTAAATGAGCATTTCCCCAC No data
Right 993617246 5:90128581-90128603 AGAGCAGGCCTAGCTTTTTATGG No data
993617240_993617247 22 Left 993617240 5:90128543-90128565 CCAGTAAATGAGCATTTCCCCAC No data
Right 993617247 5:90128588-90128610 GCCTAGCTTTTTATGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993617240 Original CRISPR GTGGGGAAATGCTCATTTAC TGG (reversed) Intergenic
No off target data available for this crispr