ID: 993617245

View in Genome Browser
Species Human (GRCh38)
Location 5:90128566-90128588
Sequence CACACTGATGAGACGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993617240_993617245 0 Left 993617240 5:90128543-90128565 CCAGTAAATGAGCATTTCCCCAC No data
Right 993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG No data
993617238_993617245 13 Left 993617238 5:90128530-90128552 CCACTGGAGATGCCCAGTAAATG No data
Right 993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG No data
993617239_993617245 1 Left 993617239 5:90128542-90128564 CCCAGTAAATGAGCATTTCCCCA No data
Right 993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993617245 Original CRISPR CACACTGATGAGACGAGAGC AGG Intergenic
No off target data available for this crispr