ID: 993620722

View in Genome Browser
Species Human (GRCh38)
Location 5:90164632-90164654
Sequence CTCAAACTGAAGTGCCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993620716_993620722 -3 Left 993620716 5:90164612-90164634 CCATGCTTAATCCCCTGATCCTC No data
Right 993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG No data
993620715_993620722 2 Left 993620715 5:90164607-90164629 CCTCACCATGCTTAATCCCCTGA No data
Right 993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993620722 Original CRISPR CTCAAACTGAAGTGCCTTCA GGG Intergenic
No off target data available for this crispr