ID: 993622357

View in Genome Browser
Species Human (GRCh38)
Location 5:90183719-90183741
Sequence CAGCTAAATGGTCCATGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993622357_993622365 9 Left 993622357 5:90183719-90183741 CCATACCATGGACCATTTAGCTG No data
Right 993622365 5:90183751-90183773 CAGCTTCCAAGGGATGGTACAGG No data
993622357_993622362 3 Left 993622357 5:90183719-90183741 CCATACCATGGACCATTTAGCTG No data
Right 993622362 5:90183745-90183767 TAAACCCAGCTTCCAAGGGATGG No data
993622357_993622361 -1 Left 993622357 5:90183719-90183741 CCATACCATGGACCATTTAGCTG No data
Right 993622361 5:90183741-90183763 GAATTAAACCCAGCTTCCAAGGG No data
993622357_993622360 -2 Left 993622357 5:90183719-90183741 CCATACCATGGACCATTTAGCTG No data
Right 993622360 5:90183740-90183762 TGAATTAAACCCAGCTTCCAAGG No data
993622357_993622366 10 Left 993622357 5:90183719-90183741 CCATACCATGGACCATTTAGCTG No data
Right 993622366 5:90183752-90183774 AGCTTCCAAGGGATGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993622357 Original CRISPR CAGCTAAATGGTCCATGGTA TGG (reversed) Intergenic
No off target data available for this crispr