ID: 993622371

View in Genome Browser
Species Human (GRCh38)
Location 5:90183828-90183850
Sequence GAAAATGTAGAGATGTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993622371_993622376 28 Left 993622371 5:90183828-90183850 CCAATCTACATCTCTACATTTTC No data
Right 993622376 5:90183879-90183901 TTCAATAATGAAACTCTATAGGG No data
993622371_993622375 27 Left 993622371 5:90183828-90183850 CCAATCTACATCTCTACATTTTC No data
Right 993622375 5:90183878-90183900 TTTCAATAATGAAACTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993622371 Original CRISPR GAAAATGTAGAGATGTAGAT TGG (reversed) Intergenic
No off target data available for this crispr