ID: 993622371 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:90183828-90183850 |
| Sequence | GAAAATGTAGAGATGTAGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993622371_993622376 | 28 | Left | 993622371 | 5:90183828-90183850 | CCAATCTACATCTCTACATTTTC | No data | ||
| Right | 993622376 | 5:90183879-90183901 | TTCAATAATGAAACTCTATAGGG | No data | ||||
| 993622371_993622375 | 27 | Left | 993622371 | 5:90183828-90183850 | CCAATCTACATCTCTACATTTTC | No data | ||
| Right | 993622375 | 5:90183878-90183900 | TTTCAATAATGAAACTCTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993622371 | Original CRISPR | GAAAATGTAGAGATGTAGAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||