ID: 993622376

View in Genome Browser
Species Human (GRCh38)
Location 5:90183879-90183901
Sequence TTCAATAATGAAACTCTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993622371_993622376 28 Left 993622371 5:90183828-90183850 CCAATCTACATCTCTACATTTTC No data
Right 993622376 5:90183879-90183901 TTCAATAATGAAACTCTATAGGG No data
993622374_993622376 -6 Left 993622374 5:90183862-90183884 CCATGACTTCAGAGCATTTCAAT No data
Right 993622376 5:90183879-90183901 TTCAATAATGAAACTCTATAGGG No data
993622373_993622376 -5 Left 993622373 5:90183861-90183883 CCCATGACTTCAGAGCATTTCAA No data
Right 993622376 5:90183879-90183901 TTCAATAATGAAACTCTATAGGG No data
993622372_993622376 -2 Left 993622372 5:90183858-90183880 CCACCCATGACTTCAGAGCATTT No data
Right 993622376 5:90183879-90183901 TTCAATAATGAAACTCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993622376 Original CRISPR TTCAATAATGAAACTCTATA GGG Intergenic
No off target data available for this crispr