ID: 993622826

View in Genome Browser
Species Human (GRCh38)
Location 5:90188273-90188295
Sequence CGGCGTTCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993622822_993622826 7 Left 993622822 5:90188243-90188265 CCAGAGGGGTGGAAAGCGGGTCT No data
Right 993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG No data
993622819_993622826 17 Left 993622819 5:90188233-90188255 CCTGCTGGATCCAGAGGGGTGGA 0: 7
1: 55
2: 94
3: 138
4: 303
Right 993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG No data
993622817_993622826 18 Left 993622817 5:90188232-90188254 CCCTGCTGGATCCAGAGGGGTGG 0: 9
1: 51
2: 111
3: 141
4: 333
Right 993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993622826 Original CRISPR CGGCGTTCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr