ID: 993629734

View in Genome Browser
Species Human (GRCh38)
Location 5:90271573-90271595
Sequence GCCTGCTTTACTTACCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993629734_993629735 -1 Left 993629734 5:90271573-90271595 CCTGGATGGTAAGTAAAGCAGGC No data
Right 993629735 5:90271595-90271617 CAAGCAAGTAAATAGAAATTAGG No data
993629734_993629736 0 Left 993629734 5:90271573-90271595 CCTGGATGGTAAGTAAAGCAGGC No data
Right 993629736 5:90271596-90271618 AAGCAAGTAAATAGAAATTAGGG No data
993629734_993629737 1 Left 993629734 5:90271573-90271595 CCTGGATGGTAAGTAAAGCAGGC No data
Right 993629737 5:90271597-90271619 AGCAAGTAAATAGAAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993629734 Original CRISPR GCCTGCTTTACTTACCATCC AGG (reversed) Intergenic
No off target data available for this crispr