ID: 993629851

View in Genome Browser
Species Human (GRCh38)
Location 5:90272662-90272684
Sequence TTTAAAAATACCACTACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993629849_993629851 19 Left 993629849 5:90272620-90272642 CCCAATTACATAAATACTTTGTT No data
Right 993629851 5:90272662-90272684 TTTAAAAATACCACTACTGAAGG No data
993629850_993629851 18 Left 993629850 5:90272621-90272643 CCAATTACATAAATACTTTGTTG No data
Right 993629851 5:90272662-90272684 TTTAAAAATACCACTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993629851 Original CRISPR TTTAAAAATACCACTACTGA AGG Intergenic
No off target data available for this crispr