ID: 993632099

View in Genome Browser
Species Human (GRCh38)
Location 5:90299074-90299096
Sequence GCTGCTGGTGAGAGAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993632092_993632099 27 Left 993632092 5:90299024-90299046 CCATGTACGGAGAAAATTGAAAG No data
Right 993632099 5:90299074-90299096 GCTGCTGGTGAGAGAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993632099 Original CRISPR GCTGCTGGTGAGAGAGGTAG GGG Intergenic
No off target data available for this crispr