ID: 993634352

View in Genome Browser
Species Human (GRCh38)
Location 5:90326167-90326189
Sequence GAGGATGTTCAGCCAGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993634350_993634352 6 Left 993634350 5:90326138-90326160 CCTCAGAGAAACACAGAGCTGCT No data
Right 993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG No data
993634349_993634352 9 Left 993634349 5:90326135-90326157 CCACCTCAGAGAAACACAGAGCT No data
Right 993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993634352 Original CRISPR GAGGATGTTCAGCCAGATAA TGG Intergenic
No off target data available for this crispr