ID: 993634514

View in Genome Browser
Species Human (GRCh38)
Location 5:90327154-90327176
Sequence CTCCAATTGCTCTCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993634514_993634517 23 Left 993634514 5:90327154-90327176 CCTGAGCCTGAGAGCAATTGGAG No data
Right 993634517 5:90327200-90327222 TGACAGCCTGCCTCTCCCTCTGG No data
993634514_993634518 24 Left 993634514 5:90327154-90327176 CCTGAGCCTGAGAGCAATTGGAG No data
Right 993634518 5:90327201-90327223 GACAGCCTGCCTCTCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993634514 Original CRISPR CTCCAATTGCTCTCAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr