ID: 993640025

View in Genome Browser
Species Human (GRCh38)
Location 5:90391261-90391283
Sequence CAGCTACCACCCCTAGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993640025_993640029 15 Left 993640025 5:90391261-90391283 CCTAGGCCTAGGGGTGGTAGCTG No data
Right 993640029 5:90391299-90391321 TGTCCTTTCTGCTTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993640025 Original CRISPR CAGCTACCACCCCTAGGCCT AGG (reversed) Intergenic
No off target data available for this crispr