ID: 993649835

View in Genome Browser
Species Human (GRCh38)
Location 5:90506626-90506648
Sequence CGATGATGCCGCAGAACAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993649835 Original CRISPR CGATGATGCCGCAGAACAGG AGG Exonic
908079040 1:60555083-60555105 TGATGAGGATGCAGAACAGGTGG + Intergenic
915408286 1:155679458-155679480 AGATGATGGCCCAGAAGAGGAGG - Exonic
915421254 1:155784035-155784057 AGATGATGGCCCAGAAGAGGAGG - Exonic
924852597 1:247845288-247845310 CGATGATGCCACAGATGAAGAGG - Intergenic
1069547260 10:69337753-69337775 CGAGAATGCTGCAGAACAGCAGG - Intronic
1069678612 10:70267516-70267538 CAATGATGCTGCAGCACAGCTGG + Intronic
1070962548 10:80509294-80509316 CGATGGTGCCACAGAACTGCAGG - Exonic
1074418446 10:113287391-113287413 CAATGATGCCGAAACACAGGAGG - Intergenic
1076942851 10:133621347-133621369 CGATGCTGCCACAGGACAGGTGG - Intergenic
1083302660 11:61747058-61747080 CGAGGTTGCAGCAGAGCAGGGGG + Intergenic
1092118935 12:6030253-6030275 CGGTGATGATGCTGAACAGGAGG - Intronic
1093248094 12:16765267-16765289 AGATGATGACGCAGAGAAGGTGG - Intergenic
1093711536 12:22334553-22334575 CCGTGATGCTGCAGAACCGGCGG - Exonic
1110088112 13:71408089-71408111 GGATGAAGCAGCAGCACAGGTGG - Intergenic
1113812078 13:113149105-113149127 CGCTGATGACGCAGAAGACGGGG + Exonic
1119848322 14:77847224-77847246 AGATGAAGCCGCAGGACAGCTGG + Intronic
1121147929 14:91602873-91602895 CAATGATGCTGCAGAACAGGAGG - Intronic
1121337280 14:93085093-93085115 CCAAGATGCCGCAGGGCAGGCGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134508192 16:14824739-14824761 CGATCCTGCCGGAGAAGAGGCGG + Intronic
1134695890 16:16223504-16223526 CGATCCTGCCGGAGAAGAGGCGG + Intronic
1134975936 16:18571184-18571206 CGATCCTGCCGGAGAAGAGGCGG - Intergenic
1135292276 16:21250202-21250224 CAAAGATACAGCAGAACAGGTGG + Exonic
1152528571 17:80903484-80903506 CAATGATGCCGCAGTGCAGCCGG - Intronic
1155728580 18:29122343-29122365 CGCTGATGTCCCAGGACAGGAGG - Intergenic
1157538414 18:48479093-48479115 CGATGATGCTGCAGAACAGGAGG + Intergenic
1160992951 19:1867891-1867913 CAAAGATGCAGCAGAAGAGGGGG + Intergenic
1165472296 19:36010563-36010585 CGATGACCCTACAGAACAGGTGG - Exonic
1167606690 19:50485136-50485158 AAATGATGCAGCAGAACAGGGGG - Exonic
1167898776 19:52602429-52602451 CGAGGATGGAGCAGAAAAGGTGG + Intronic
1167903115 19:52637128-52637150 CGAGGATGGAGCAGAAGAGGTGG - Intronic
1167940309 19:52941425-52941447 CGACGATGGAGCAGAAGAGGTGG - Intronic
1168096471 19:54118311-54118333 CGAAGAGGCAGCAGAAGAGGAGG + Exonic
937960344 2:127453469-127453491 CCAGGATGCCGCTGGACAGGAGG + Intronic
938505254 2:131873397-131873419 TGATGGTGCCACATAACAGGAGG - Intergenic
941982800 2:171478049-171478071 GGATGATGACCCAGAACAAGAGG + Exonic
942239583 2:173947963-173947985 CGATGATGCAGGAAAATAGGAGG - Intronic
947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG + Intronic
948306574 2:236952617-236952639 CGATTTTTCCGCAGACCAGGTGG - Intergenic
1172134003 20:32675138-32675160 CAAGGATGCAGCAGGACAGGAGG - Intergenic
1175917680 20:62434488-62434510 TGATCATGCCCCAAAACAGGAGG - Intergenic
953373938 3:42412982-42413004 AGTTGATTCCGCAGAACAGTTGG - Intergenic
953927818 3:46991271-46991293 CGAGGACGGCGCAGAAGAGGTGG - Exonic
955959007 3:64319841-64319863 CGATGGTGACTCAGATCAGGTGG + Intronic
960945104 3:122961049-122961071 TGATGATGCCCCAGATGAGGGGG + Intronic
968728474 4:2259047-2259069 CCAGGATGCCGCTGCACAGGTGG + Intronic
971067175 4:23046180-23046202 TGATGATGAAGCAGCACAGGAGG + Intergenic
971363019 4:25954110-25954132 AGATGATGCCTCAGAGCATGGGG + Intergenic
986016755 5:3764117-3764139 CGATGCAGTCGCAGGACAGGTGG - Intergenic
993649835 5:90506626-90506648 CGATGATGCCGCAGAACAGGAGG + Exonic
999725260 5:154431499-154431521 GGATGAAGCTGCAGAGCAGGGGG - Intergenic
1002269062 5:178057874-178057896 CGATGGTGCCACGGGACAGGTGG + Intergenic
1002781073 6:366533-366555 CCATGAAGCCGCAGAAACGGGGG + Intergenic
1017572250 6:155758689-155758711 TGTTGATGCAGAAGAACAGGGGG + Intergenic
1021413590 7:20355983-20356005 AGATGATCCCTCAAAACAGGGGG - Intronic
1031384958 7:121138124-121138146 TAAGGATGCCTCAGAACAGGTGG + Intronic
1035828575 8:2669941-2669963 CGACAATGCTGCAGATCAGGAGG + Intergenic
1045724575 8:105157677-105157699 TGAAGATGCAGCATAACAGGTGG - Intronic
1055269143 9:74536279-74536301 TGATGATGCTGAAGAAGAGGAGG + Intronic
1060446292 9:123691314-123691336 TGATGATGCTGCAACACAGGTGG + Intronic
1185658009 X:1701665-1701687 CGTTGATGACTCAGCACAGGTGG + Intergenic
1196909283 X:120469166-120469188 CCATGACCCCGCAGAGCAGGCGG + Exonic
1201386102 Y:13441073-13441095 TGATGAAGCCACAGAATAGGAGG + Intronic