ID: 993651876

View in Genome Browser
Species Human (GRCh38)
Location 5:90531300-90531322
Sequence GACAAAATGCTTGTTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993651876_993651881 19 Left 993651876 5:90531300-90531322 CCAGTAGGAACAAGCATTTTGTC 0: 1
1: 0
2: 0
3: 14
4: 98
Right 993651881 5:90531342-90531364 CCAGTGCTCAGCAGAGCCAAAGG 0: 1
1: 0
2: 3
3: 35
4: 303
993651876_993651877 -10 Left 993651876 5:90531300-90531322 CCAGTAGGAACAAGCATTTTGTC 0: 1
1: 0
2: 0
3: 14
4: 98
Right 993651877 5:90531313-90531335 GCATTTTGTCTTTGAGAAAAAGG 0: 1
1: 0
2: 2
3: 38
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993651876 Original CRISPR GACAAAATGCTTGTTCCTAC TGG (reversed) Intronic
901706216 1:11075366-11075388 AACAAAATGCTGCTTCCAACTGG + Intronic
909387096 1:75069932-75069954 GACAATATGCATGAACCTACAGG + Intergenic
912749443 1:112273744-112273766 GACACAAAGTTTGATCCTACAGG + Intergenic
914954714 1:152151122-152151144 AACAAAATCCTTGTTCTTATGGG + Intergenic
918016717 1:180641366-180641388 GACTCAAAGCTTGTTCCTCCAGG + Intronic
920060226 1:203222310-203222332 GACAAAATCCAGGTTCCTGCAGG + Exonic
922016034 1:221648193-221648215 CACCAAATGGTTGTTCCCACTGG - Intergenic
923374319 1:233344975-233344997 GAAAAAATGCTTATCACTACTGG + Intronic
1067076727 10:43191684-43191706 GTCAGAATGTTTGTTTCTACTGG + Intergenic
1067239092 10:44475215-44475237 GGCCAAATGCTTGTTGCTATGGG - Intergenic
1069024493 10:63524367-63524389 GACAAAGTGCTTCTACATACAGG - Intronic
1070701216 10:78602975-78602997 GACAAATTCCTTGTTCCCTCAGG + Intergenic
1071174329 10:82906636-82906658 GACAAAACCTTTTTTCCTACTGG - Intronic
1073374563 10:103021825-103021847 GAGAAAATACTGGTTCCTAGAGG + Intronic
1080553495 11:33394741-33394763 GACAAAATGAGTGTTCCTGATGG + Intergenic
1085882779 11:80487590-80487612 GACAGAATGCATGCTCCAACTGG + Intergenic
1087223582 11:95572822-95572844 GATAAAATACATTTTCCTACTGG - Intergenic
1088414723 11:109576292-109576314 GAAAAAATGCTTGTCACCACTGG + Intergenic
1089599580 11:119605157-119605179 AAGAAAATTCTTGTCCCTACCGG - Intergenic
1090650445 11:128801515-128801537 GGCTAAAAGCTTGTTCCCACAGG - Intronic
1092079421 12:5702536-5702558 GAGAAAATGCTCATTCTTACTGG + Intronic
1092551265 12:9502833-9502855 CACAAAATGCTTGTGCCAACTGG - Intergenic
1094520542 12:31183500-31183522 CACAAAATGCTTGTGCCAACTGG + Intergenic
1097428929 12:59479417-59479439 GACAAAATGCTTGTCATCACTGG - Intergenic
1106717791 13:32409005-32409027 TACAAAATGTTTTTTCATACTGG - Intronic
1107669578 13:42730802-42730824 GAGAAGCTGCTTGTTCCTACTGG + Intergenic
1109289268 13:60454267-60454289 GAGAAGATACTTGTTCCTATTGG + Intronic
1109602091 13:64644372-64644394 GACAAAATATTTCTTACTACAGG + Intergenic
1115287349 14:31730184-31730206 GAGAATATGCTTATTCCTATGGG - Intronic
1116142372 14:41015237-41015259 GAAAAAATGCTCATCCCTACAGG + Intergenic
1119680776 14:76590832-76590854 GACAACCTGCTTGTTTCAACAGG - Intergenic
1120595656 14:86432133-86432155 CAGAAAGTCCTTGTTCCTACTGG + Intergenic
1120798403 14:88661697-88661719 GACAAAATGGTTCTAGCTACCGG - Exonic
1130645560 15:85723441-85723463 AACTAAATGCTTGTTGCTCCTGG - Intronic
1133079151 16:3305095-3305117 GACAAAATGCCTCTTCCTCGAGG + Intronic
1141162585 16:81639109-81639131 GCCAGAATCCTGGTTCCTACAGG + Intronic
1142704205 17:1684251-1684273 GACAAAATTCCTGTCCTTACGGG - Intronic
1142909716 17:3078801-3078823 GACAAAATGGTTGATTCCACAGG - Intergenic
1143251796 17:5528286-5528308 GACAAGTTACTTGTTCCCACCGG - Intronic
1143359629 17:6358381-6358403 AAAGAAATGCTTGTTCCTGCAGG - Intergenic
1149954585 17:61034541-61034563 GGCAAAATGCATGTTCATACTGG + Intronic
1151482994 17:74381067-74381089 GACAAAGGGCTTGGTCCTATTGG + Intergenic
1156121781 18:33852402-33852424 GCCAAATTTCTTGTTGCTACAGG - Exonic
1157020740 18:43778624-43778646 GAGAAAATGGTGATTCCTACAGG - Intergenic
1159414812 18:68131667-68131689 GGCAAAATACATATTCCTACAGG - Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
926354413 2:12027404-12027426 GACAAAATGCTTCATCATCCAGG - Intergenic
931833072 2:66072482-66072504 GACTAATTGCTTGTTCTTGCAGG + Intergenic
931839165 2:66130463-66130485 GACAAGGTGCTTGGCCCTACAGG - Intergenic
937251829 2:120528731-120528753 GAGAAAATGCCTGTTGCTGCCGG - Intergenic
939648381 2:144730490-144730512 CACAAAATGCTTGTGACTGCAGG - Intergenic
939733394 2:145813210-145813232 AACAATATTCTTGTTCATACCGG - Intergenic
940197955 2:151116751-151116773 GTCAGAATGATTTTTCCTACAGG - Intergenic
941324647 2:164098505-164098527 GGGAAAATGCTTGTGCCTAAAGG - Intergenic
941751440 2:169139010-169139032 GTCCAAATGGTTGTGCCTACTGG - Intronic
948349804 2:237329888-237329910 CACAAAATGATGGTTCCTTCAGG + Intronic
1169665999 20:8036594-8036616 TACAAAATGGTACTTCCTACTGG - Intergenic
1171189589 20:23149775-23149797 TACAAAAGGCTTGTTCCTAGAGG - Intergenic
1172998692 20:39090347-39090369 TGCAAAATGCATGTCCCTACAGG - Intergenic
1179052138 21:37897057-37897079 GCCACAGTGTTTGTTCCTACAGG - Intronic
949713767 3:6903622-6903644 GAGAAACTGCCTGTTCCTAGAGG - Intronic
960002292 3:112745444-112745466 GAAAAAATGCTGGTATCTACTGG + Intronic
961461198 3:127051443-127051465 GACAAAACCCTTGTTCTCACAGG - Intergenic
963459166 3:145586142-145586164 GAGAAAATGCTTGTTCCCTCTGG - Intergenic
966323768 3:178731451-178731473 GACAATATGTTTCTTCCCACGGG - Intronic
967304033 3:188043527-188043549 AAAAAAATGCTTCTCCCTACTGG + Intergenic
967589675 3:191258822-191258844 CAATAAATGCTTGTTACTACAGG - Intronic
968280928 3:197476197-197476219 AACAAAATGCTAGCTCCTCCAGG + Intergenic
975361463 4:73476391-73476413 TACAAAATGCTTTGTGCTACTGG - Intergenic
975524132 4:75330926-75330948 AACAAAATGTTCCTTCCTACAGG + Intergenic
978726988 4:111980543-111980565 GACGACATGCTTGTCCATACAGG - Intergenic
979844507 4:125490818-125490840 GTCAAACTGCTTGCTCCTAAGGG - Exonic
984427443 4:179605803-179605825 GCCAAAATGCATTTTCCTATAGG + Intergenic
988927168 5:36001332-36001354 GCCAAAATGCTTCTTTGTACTGG + Intergenic
991642828 5:68771520-68771542 GAGAAAATACCTGTTCCTTCTGG + Intergenic
993651876 5:90531300-90531322 GACAAAATGCTTGTTCCTACTGG - Intronic
994607213 5:101983371-101983393 AAGAATATGTTTGTTCCTACTGG - Intergenic
995384392 5:111572851-111572873 CACAAAATGCTTGTTCTTGTGGG - Intergenic
995434292 5:112118628-112118650 GACAAAACGAATCTTCCTACTGG + Intergenic
999353471 5:150901136-150901158 GATTAAATGCTTCTTCCTTCAGG - Intronic
1001375520 5:171253259-171253281 GAGAAAATGCATGTTAATACTGG - Intronic
1002107334 5:176886695-176886717 GAACAAATGCTGGTTCCTGCAGG + Intronic
1006823591 6:36917638-36917660 GACAAAATGATTGTTTTTATAGG - Intronic
1010521622 6:76845234-76845256 GAAAAAATGCTTATTATTACTGG - Intergenic
1013829022 6:114250662-114250684 GACAAAATGTCTCTTCCTTCAGG - Intronic
1015721578 6:136248221-136248243 GACAATATGCTTGTTTCTGCAGG - Intronic
1017289091 6:152713953-152713975 GACCAAATGCTTGTAGCTACTGG - Intronic
1022569728 7:31440204-31440226 GACAAAATGCTTTTTTATCCAGG + Intergenic
1022755677 7:33286251-33286273 CACAAAAGGATTTTTCCTACCGG - Intronic
1023451513 7:40290899-40290921 GAAAAAATGCTTGTCATTACTGG + Intronic
1024702427 7:51918592-51918614 GAGTAAATGCTTCTTCCTCCTGG + Intergenic
1026469618 7:70684045-70684067 GACAAAATATTTGCTTCTACTGG - Intronic
1035425737 7:158771552-158771574 GACTAAATGCTTGTAGCTGCAGG + Intronic
1036391981 8:8331489-8331511 GACAAAATGCATGTTCAGAGAGG - Intronic
1036417912 8:8567377-8567399 GCAGAAATGTTTGTTCCTACAGG - Intergenic
1036474483 8:9080769-9080791 CACTAAATGCTTGTTCCTGCAGG - Intronic
1036500674 8:9311173-9311195 GAAAAAGTGCTTGTTCCTAAAGG + Intergenic
1037436465 8:18869078-18869100 GACCAAATGCTTGTTCTTAATGG + Intronic
1038459653 8:27705165-27705187 GAGAAAATGCATGTTCCAATGGG + Intergenic
1042972594 8:74427109-74427131 TACAAAAGGCTTTTTCCTCCTGG + Intronic
1046551446 8:115722925-115722947 GACAAAATCCTTGTCCCTAGAGG + Intronic
1055015596 9:71614504-71614526 GACAAATTGCTTTTTCATAGAGG + Intergenic
1057205510 9:93169717-93169739 GACAAAATGCTAGCTCAAACTGG - Intergenic
1061151064 9:128828616-128828638 GACAAGATGTTTGGACCTACTGG + Intronic
1186602334 X:11051179-11051201 GTCAAAGTGCATGTTCCTGCTGG + Intergenic
1187944222 X:24410822-24410844 AACAAAATGCTTCTTGCTATTGG - Intergenic
1191961044 X:66702694-66702716 GTCAGACTGCTAGTTCCTACTGG - Intergenic
1192800109 X:74457631-74457653 GACAAATTGTTTGTGCCTACTGG - Intronic
1193692427 X:84662508-84662530 AAACAAATGCTTGTTCTTACAGG + Intergenic
1196177881 X:112660315-112660337 GAATAAATCCTAGTTCCTACTGG - Intronic
1197740258 X:129886419-129886441 GAGAAAATGCTTTTTATTACTGG - Intergenic
1198083223 X:133259344-133259366 GACAGAAAACTTGTTCCTCCTGG + Intergenic
1198795608 X:140391034-140391056 GATAAAATCCTTCTTCCTGCGGG + Intergenic