ID: 993653006

View in Genome Browser
Species Human (GRCh38)
Location 5:90544489-90544511
Sequence CATCTGTGGGGACCCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993653006 Original CRISPR CATCTGTGGGGACCCCAACA TGG (reversed) Intronic
901702703 1:11054031-11054053 CAAGTGTGGGCACCCCACCAGGG - Intergenic
901825436 1:11858322-11858344 CATCCGTGGGCACCGCAAAATGG - Exonic
903300196 1:22373400-22373422 CATCTGTGGGGAGCTCAACTGGG - Intergenic
904301175 1:29555913-29555935 CATCAGTGGGGACCCCTCCCAGG - Intergenic
904838442 1:33354709-33354731 CATCTTTGGGGATTCCAAGAAGG - Intronic
904904065 1:33881268-33881290 CATTTGTGGGAACCCCAAGGAGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
909483656 1:76151442-76151464 CCTCTGTGGGAACCCAAACTAGG - Intronic
914883319 1:151564630-151564652 CCTCGGTGGGGACCCAACCATGG - Intronic
915480019 1:156178078-156178100 CAACTGTGGGGGCCGCAGCAGGG - Intergenic
915504500 1:156345124-156345146 TAGCTATGGGGAACCCAACAGGG + Intronic
916582446 1:166121194-166121216 CATCGGTGTGGACACCATCAAGG + Intronic
920860912 1:209705793-209705815 CATCTCTGGGGAACCCCAAAAGG - Exonic
922055861 1:222041888-222041910 GGACTGTGGGGACACCAACAAGG + Intergenic
922616757 1:226965326-226965348 CGGCTGTGAGGCCCCCAACAGGG - Exonic
923420368 1:233808982-233809004 CACCTGTGTGTACACCAACATGG - Intergenic
1062921314 10:1282054-1282076 AACCTGTGGGGACCCCAGCCAGG - Intronic
1063567137 10:7180689-7180711 CATCTGGGAGGAACCCACCAGGG + Intronic
1064502866 10:15993807-15993829 CATCTGTGGGAACCCACAAATGG + Intergenic
1069509329 10:69029806-69029828 CTGCTGTGTGGACCCCAACTGGG + Intergenic
1070829410 10:79409482-79409504 AATCAGAGGGGACCCCTACAGGG - Intronic
1073811060 10:107152490-107152512 CATGTGTGGGGTCCCCATCCAGG - Intronic
1075410687 10:122225841-122225863 CTTATTTGGGGACCCCAGCAGGG + Intronic
1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG + Exonic
1076324404 10:129609819-129609841 CACCTGGGGGGACACCACCACGG + Intronic
1076424571 10:130358466-130358488 CATTTGTGTGGCCTCCAACAGGG - Intergenic
1077047212 11:551916-551938 CCTCTGTGGGAACCCCACCAAGG + Exonic
1077273054 11:1690823-1690845 CGTCTGTGGGGAGTGCAACAGGG + Intergenic
1078001199 11:7497517-7497539 CAGCTGTAGGGACCCCATCGTGG + Intronic
1078625370 11:12950963-12950985 CATGTGTGGGGTGCCCACCAAGG + Intergenic
1080897237 11:36456844-36456866 CTGATGTGGGGCCCCCAACAGGG - Intronic
1086746337 11:90432221-90432243 CATATCTGGAGACCTCAACAGGG + Intergenic
1087046799 11:93849979-93850001 CTACTGTGGGGACCCCTCCATGG - Intronic
1090423508 11:126591596-126591618 CAGCTCTGGGGGCCCCATCAGGG + Intronic
1093655135 12:21686138-21686160 CATCTTTAGAGACCACAACATGG + Intronic
1102977956 12:117220167-117220189 CGTCTGTGGGGACGTCACCATGG - Exonic
1108024011 13:46159856-46159878 CATCTTTGGAGACCACCACATGG - Intronic
1111887422 13:94039766-94039788 CATCTGTATGGAGCCCAAGATGG - Intronic
1112586715 13:100724945-100724967 TTGCTGTGGGGTCCCCAACAGGG + Intergenic
1117970743 14:61248534-61248556 CATCTGAGGGGGCCTGAACAAGG + Intronic
1121090468 14:91178048-91178070 CTGCTGTGGGCACCCCAGCATGG + Intronic
1122385222 14:101340584-101340606 CATCTGTGAGTTCCCAAACAAGG + Intergenic
1128804768 15:70522431-70522453 CACCTGTGGGGATCCCAGGAGGG + Intergenic
1130550340 15:84886569-84886591 CCAGGGTGGGGACCCCAACACGG - Intronic
1130910853 15:88269930-88269952 CAGCTTTGGGAAGCCCAACAAGG + Intergenic
1132568911 16:635590-635612 GGTCTGTGGGGAGCCCAGCATGG - Exonic
1132618003 16:851858-851880 CACCTCTGGGTACCCCACCAAGG - Intergenic
1137612531 16:49828609-49828631 GGTCTGTGGGTTCCCCAACAGGG - Intronic
1137928488 16:52564282-52564304 CATTGCTGGGGACCCCTACAAGG + Intergenic
1138176216 16:54900629-54900651 CCTCTGTGGGGACCAAAACCAGG + Intergenic
1140565358 16:76035522-76035544 CACCCCTGGGGACCCCAACCAGG - Intergenic
1143031603 17:3971116-3971138 CATCTCTGGGGGCCTCCACAGGG - Intergenic
1148075860 17:44934863-44934885 CATCCGCGAGGACCCCGACAAGG - Exonic
1149531110 17:57396008-57396030 CATCTGTGGGAACCCCAAGGTGG - Intronic
1149575729 17:57711312-57711334 CACCTTTGGGGACCCTCACATGG + Intergenic
1150275138 17:63892459-63892481 CATCTTTGCGGTCCCTAACACGG + Intergenic
1151194263 17:72420703-72420725 CATCTCTGAGGACCTCTACAGGG - Intergenic
1154151054 18:11906983-11907005 CATCTGCATGGACCCCACCAAGG + Intronic
1156999757 18:43510417-43510439 CATCTGAGGGGCCCCAAGCAGGG + Intergenic
1161027325 19:2042606-2042628 CCTCTGTGAGCACCCCAACCAGG - Exonic
1162896060 19:13765221-13765243 CATCTGTGGGGCCCTGGACAAGG - Intronic
1162896074 19:13765273-13765295 CATCTGTGGGGCCCTGGACAAGG - Intronic
1163495806 19:17645992-17646014 CATCTATGGGAACCTCAACCCGG - Exonic
925161678 2:1688593-1688615 CAGCTTGGGGGACCCCAAGAAGG + Intronic
931020588 2:58040578-58040600 CTTCTGTGTGGACCACAACTTGG + Intronic
931554657 2:63489090-63489112 CATATGGGGGCAACCCAACATGG + Intronic
932628065 2:73314661-73314683 CAGCTGTGAAGACCCCAGCAGGG - Intergenic
934881322 2:97982928-97982950 CATTTGTGTGGCCTCCAACAAGG - Intronic
936481850 2:112891930-112891952 CCTCTGTAGGGAACCCAAGAGGG - Intergenic
938631842 2:133176103-133176125 CTTTTGTTGGGAACCCAACAGGG - Intronic
940023547 2:149181142-149181164 CATCTGTTGGAACTCCAGCAGGG + Intronic
942222209 2:173781081-173781103 CAACTGGGGGGATCCAAACAGGG - Intergenic
943579888 2:189672861-189672883 CATGTGTGTGAACCCCAAGAGGG + Intergenic
946243351 2:218370487-218370509 CATCTGTGGGGAACCGAAACAGG + Intergenic
1170088684 20:12566357-12566379 CTTCTGTGGGCTCCCCATCAAGG + Intergenic
1171953718 20:31443173-31443195 AGTCAGTGGGGACCCCAAAAGGG - Intronic
1171967071 20:31538610-31538632 CATGTGTGAGGAGCCCAACATGG - Intronic
1175682378 20:60999111-60999133 CATTTGTGGGCTCCCCATCATGG - Intergenic
1179674685 21:42973912-42973934 CCTCTGTGAGGACCCCAGCAAGG - Intergenic
1184414073 22:44342079-44342101 CAGCTGTGGGGACGCCAGCCCGG + Intergenic
1184726043 22:46347205-46347227 CATCAGTGGGGACCCCTGAAGGG + Intronic
1184924348 22:47626584-47626606 CATGTGTGGGGACCCCAGGCCGG - Intergenic
954647141 3:52138438-52138460 GAGCTGTGGGGAACCCAACAAGG + Intronic
955940331 3:64141003-64141025 CATCTGTGGCGACTACAAAAGGG + Intronic
962750820 3:138433985-138434007 CATCTGTGGGGCGCCCAACAAGG - Intergenic
963909929 3:150808122-150808144 CTTCTGTGGGGTCACAAACAGGG - Intergenic
965311708 3:167136349-167136371 AATGTGTGGGGAAACCAACATGG + Intergenic
969462861 4:7337956-7337978 CATCTGTGGGGACCACAGAGAGG - Intronic
980483150 4:133415945-133415967 CATCTGTGGAGACCCAAGCTTGG + Intergenic
981608785 4:146569917-146569939 CATCTGTGTGTATCACAACACGG - Intergenic
984447412 4:179854430-179854452 CAGCTGTGGGTTCCCAAACAAGG - Intergenic
985563580 5:604057-604079 CATCACTGGGGTCCCCAACCCGG - Intergenic
985692431 5:1320906-1320928 CAGCTGTGGGGAGCCCATGAGGG - Intronic
987466005 5:18272873-18272895 CAGCTATGGGGACCCCATCCAGG + Intergenic
992313032 5:75522146-75522168 CTTCTGTCAGGACCCCAAGATGG + Intronic
993653006 5:90544489-90544511 CATCTGTGGGGACCCCAACATGG - Intronic
1004900215 6:20186570-20186592 AATCTGGAGGGTCCCCAACAAGG + Intronic
1006311978 6:33267380-33267402 TATCTGTGGGGACCCCAGACAGG + Intronic
1006434748 6:34020303-34020325 CATCTGTGGGGCCCCCATCTAGG - Intronic
1006828546 6:36954829-36954851 CATCTGTGAGGGCTCCAACGGGG - Exonic
1012950315 6:105511493-105511515 GATCTGTGTAGACCCCATCAAGG + Intergenic
1015603420 6:134932820-134932842 CATCTTTGAGGACGCCAACCTGG - Exonic
1019032091 6:169022580-169022602 CATCTGTGGGAATCCAAAGATGG + Intergenic
1022473110 7:30693795-30693817 CTTCTCTGGGGACCCCAACTGGG - Intronic
1024630728 7:51244701-51244723 CACGTGCGGTGACCCCAACAGGG + Intronic
1029493909 7:100887103-100887125 CACCTGTGAGTACCCCAACGAGG + Exonic
1033125432 7:138702954-138702976 CATCTGTGTGACCCCCAGCAAGG - Intergenic
1033238987 7:139661415-139661437 CATCTGTGGTGTCTTCAACATGG + Intronic
1039657571 8:39426636-39426658 CATCTGTGTGGACCACCAAAGGG + Intergenic
1041159071 8:55018648-55018670 TATCTGTGGGGACCCAACAAGGG + Intergenic
1041963303 8:63645574-63645596 CACCTGTGAGGACCTCACCATGG - Intergenic
1047840245 8:128744046-128744068 CATCAGTAGGGACCTCAAAAAGG + Intergenic
1048344644 8:133567573-133567595 CATCTGTGGGGACTCCCAAATGG - Intronic
1049350284 8:142160692-142160714 CATCTGTGGGGGTCCCACCCAGG - Intergenic
1050462910 9:5892498-5892520 CATCTATGGTTACCCCAAGAAGG + Exonic
1051745359 9:20290329-20290351 CAGCTGTGGGCTCCTCAACATGG - Intergenic
1052935034 9:34085847-34085869 CATCTCTGGGAAACCCACCAGGG - Intergenic
1053618688 9:39794569-39794591 CACTTGTGGGGAGTCCAACAGGG - Intergenic
1054265467 9:62912860-62912882 CACTTGTGGGGAGTCCAACAGGG + Intergenic
1055300514 9:74877679-74877701 AATGTGTGGTGACCCCAATATGG - Intronic
1056846366 9:90041236-90041258 CATCTGTGGAGACCAACACAGGG + Intergenic
1059488164 9:114643413-114643435 CATCTGGGGGCACTCCAAAAGGG + Exonic
1061392000 9:130321870-130321892 CAGCTGTGTGGCCACCAACACGG + Intronic
1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG + Exonic
1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG + Intronic
1062042373 9:134409991-134410013 CCTGTTTGGGGACCCCACCAGGG - Intronic
1188440370 X:30210049-30210071 CATCTCTGGGGATCCCAGGAAGG + Intergenic
1188588771 X:31808512-31808534 CATGTGTTGCAACCCCAACAGGG - Intronic
1191180072 X:57552844-57552866 CTTCTGTGGTCACCACAACAAGG - Intergenic
1192392192 X:70741775-70741797 TAACTGTGTGGACCCCAAAAAGG + Intronic
1196993072 X:121348778-121348800 AATCTGTGTGGACCCCAAAATGG - Intergenic
1200135490 X:153872635-153872657 CATCTGTGGGGAAGACAACCAGG + Exonic