ID: 993654631

View in Genome Browser
Species Human (GRCh38)
Location 5:90562435-90562457
Sequence AGGTGTGGCAGAGGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1421
Summary {0: 1, 1: 0, 2: 11, 3: 144, 4: 1265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993654624_993654631 -2 Left 993654624 5:90562414-90562436 CCAGCTCTGTTGCCCTGAGTGAG 0: 1
1: 0
2: 1
3: 30
4: 327
Right 993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG 0: 1
1: 0
2: 11
3: 144
4: 1265
993654623_993654631 -1 Left 993654623 5:90562413-90562435 CCCAGCTCTGTTGCCCTGAGTGA 0: 1
1: 0
2: 0
3: 29
4: 363
Right 993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG 0: 1
1: 0
2: 11
3: 144
4: 1265
993654620_993654631 20 Left 993654620 5:90562392-90562414 CCACACATGAAGCCACAGCACCC 0: 1
1: 0
2: 1
3: 21
4: 208
Right 993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG 0: 1
1: 0
2: 11
3: 144
4: 1265
993654621_993654631 8 Left 993654621 5:90562404-90562426 CCACAGCACCCCAGCTCTGTTGC 0: 1
1: 0
2: 3
3: 30
4: 396
Right 993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG 0: 1
1: 0
2: 11
3: 144
4: 1265
993654622_993654631 0 Left 993654622 5:90562412-90562434 CCCCAGCTCTGTTGCCCTGAGTG 0: 1
1: 0
2: 1
3: 35
4: 293
Right 993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG 0: 1
1: 0
2: 11
3: 144
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993654631 Original CRISPR AGGTGTGGCAGAGGAGGAGA AGG Intronic
900278926 1:1852820-1852842 GGGTGTGGCAGATGTGGAGCTGG - Intronic
900423157 1:2564424-2564446 AGGGGTGGCAGGAGAGGAGTTGG - Intronic
900486469 1:2925040-2925062 AGAGCGGGCAGAGGAGGAGATGG + Intergenic
900626370 1:3610492-3610514 ACGTGCGGCAGTGGAGGAGGAGG - Intronic
900744680 1:4352938-4352960 AGGTGTGGCAGGGTGGGAGTTGG + Intergenic
900971864 1:5996301-5996323 GGATGTGGCAGAGGACAAGAGGG - Intronic
901000040 1:6144354-6144376 GGATGTGGCAGAGCTGGAGAGGG + Intronic
901203478 1:7480457-7480479 AGGGGGAGAAGAGGAGGAGAGGG - Intronic
901207699 1:7506227-7506249 AGGTGTGGCAAAGGAGAGCAGGG + Intronic
901380095 1:8867340-8867362 AGGTGTGATGGGGGAGGAGATGG - Intronic
901387749 1:8922165-8922187 TGGTTTGAGAGAGGAGGAGAAGG - Intergenic
901414321 1:9106299-9106321 GGGGGTGGCAGAGGCGGAGGAGG - Intronic
901740375 1:11338150-11338172 AGGGGGGGGAGAAGAGGAGAAGG - Intergenic
901842657 1:11963879-11963901 AGGTGAGGCCAAGGAGGAGGAGG - Intronic
902667969 1:17952745-17952767 GGCTGGGGGAGAGGAGGAGAGGG + Intergenic
902767440 1:18626780-18626802 AAGAGAGGAAGAGGAGGAGAAGG + Intergenic
902818582 1:18929820-18929842 AGTGGTGCCAGAGGAGGGGAAGG - Intronic
902821739 1:18947642-18947664 AGGGCTGGCAGGGGAGGAGTTGG - Intronic
903006856 1:20304262-20304284 TGGAGTGTCAGAGAAGGAGAAGG + Intronic
903139820 1:21332704-21332726 AGGTGAGGGAGGGGAGGGGAGGG + Intronic
903220954 1:21869493-21869515 AGCTGAGGAAGAGGAGGAGGAGG + Intronic
903344387 1:22675189-22675211 TGGAGTGGGAGATGAGGAGACGG - Intergenic
903420162 1:23213146-23213168 AGGTGTGGAAGAACAGGATAAGG - Intergenic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903768524 1:25749825-25749847 AGGGGTGGCTGTGGAGGACAAGG - Intronic
904048425 1:27623368-27623390 TGGTGGGGAAGAGGAGGAGTGGG - Intronic
904052900 1:27650882-27650904 AGGTGTCCCAGGGAAGGAGAAGG + Intergenic
904128709 1:28260162-28260184 CGGTGAGGGAGAGGGGGAGAGGG - Intronic
904238225 1:29127576-29127598 TGGGGTGGCAGAGGAGGGAAGGG + Intergenic
904322721 1:29707569-29707591 AGGGGAGGCAGGAGAGGAGAGGG + Intergenic
904457008 1:30653852-30653874 GGGTGTGGGGGAGGAGGTGAAGG + Intergenic
904467812 1:30718575-30718597 GGGGGGGGCAGAGGCGGAGACGG - Intronic
905172653 1:36118339-36118361 AGGTGGGGTAGAGCAGGAGTAGG - Intronic
905282690 1:36859322-36859344 ACCTGTGGCAAGGGAGGAGAAGG - Intronic
905292965 1:36935527-36935549 AGATGGGGGAGGGGAGGAGAAGG - Intronic
905318996 1:37102368-37102390 AAGGGTGGCAGAGGATGAGTTGG + Intergenic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
905467888 1:38169332-38169354 ATGTGTGGCAGAGGCTGAGTGGG + Intergenic
905647384 1:39633827-39633849 AGGTGGGGGTGAGGAGGAGGAGG - Intronic
905874897 1:41426423-41426445 AGGTGGGAGAGAGGAGCAGACGG + Intergenic
905906793 1:41623775-41623797 AGGGCTGGCACAGGAGGAGGAGG - Intronic
905956558 1:42002217-42002239 GTGGGTGGCAGAGGAGGAGGAGG - Intronic
906265343 1:44424685-44424707 AGCAGTGGCAGAGGGGGAGCCGG - Intronic
906532405 1:46531353-46531375 AGGAGAGACAGAGGTGGAGATGG + Intergenic
906577028 1:46900321-46900343 GGTTGTACCAGAGGAGGAGATGG - Intergenic
906594936 1:47067582-47067604 GGTTGTACCAGAGGAGGAGATGG + Exonic
906668083 1:47635754-47635776 AGGGGAGGCAGAGGAGGAAAAGG - Intergenic
906934324 1:50198760-50198782 GGGTGGGGCAGTGGAGGAGGTGG - Intronic
906980083 1:50620842-50620864 TGGTGTGGGAGGGGAGGAGATGG + Intronic
907236519 1:53054130-53054152 AGGTCTGGTAGAGGAGGACAAGG + Intergenic
907255146 1:53173443-53173465 AGGGAGGGGAGAGGAGGAGAGGG - Intergenic
907255153 1:53173462-53173484 AGGGAGGGGAGAGGAGGAGAGGG - Intergenic
907255160 1:53173481-53173503 AGGGAGGGGAGAGGAGGAGAGGG - Intergenic
907255167 1:53173500-53173522 AGGGAGGGGAGAGGAGGAGAGGG - Intergenic
907384338 1:54116352-54116374 AGGTGAGTCAGAGGAGGTGTTGG + Intergenic
907667350 1:56445045-56445067 AGTTGGGGCAGAGGTGGAGGTGG - Intergenic
907671113 1:56475715-56475737 CGCTGTGGCAGAGTAGGAAAGGG + Intergenic
907719794 1:56960981-56961003 AGCTATGGAAGAGGAGGAGATGG + Intronic
907859524 1:58338283-58338305 AGGTGAGGGAGAGCAGGAGGAGG - Intronic
907872302 1:58454375-58454397 AGGTGGGCCAGAGCAAGAGAAGG + Intronic
908489941 1:64633436-64633458 AGGTTACGCTGAGGAGGAGAGGG + Intronic
908511086 1:64850510-64850532 AGGGGTGGCAGGGCAGGAGGTGG - Intronic
908581937 1:65525620-65525642 AGGTGGGGCTGAGCAGGAGCAGG - Intronic
908783243 1:67711005-67711027 AGGGGTAGCAGAGCAGGAGAAGG - Intronic
909344799 1:74572607-74572629 AGATGTGGAAGGGGAAGAGATGG - Exonic
909888794 1:80976734-80976756 AGATGAGGAAGAGGAGAAGAAGG + Intergenic
910087335 1:83419173-83419195 TGCTGTGCCACAGGAGGAGATGG + Intergenic
910286109 1:85556104-85556126 GGGTGAGGAGGAGGAGGAGAAGG - Intronic
910646936 1:89524706-89524728 AGCAGTGGCGGAGGAGGAGGAGG - Intergenic
910950877 1:92647069-92647091 ATGTGAGGAAGAGGAGGAGGAGG - Intronic
911084483 1:93965084-93965106 AGGCCTGGCAGAGGAGAGGATGG - Intergenic
911502627 1:98707150-98707172 AGTTTTGGCTGAGGAGGAGAAGG + Intronic
911729327 1:101276570-101276592 AGAGGTAGCAGAGGTGGAGAAGG - Intergenic
912208746 1:107535729-107535751 AGTAGTGGCAGAGGAAGAGAGGG - Intergenic
912495094 1:110086383-110086405 AAGTGTGGCTGAGGAAGAGCTGG - Intergenic
912517983 1:110227784-110227806 AGGTGTGGAAGAGGCCGTGAGGG + Intronic
912520858 1:110243706-110243728 GGGAGGGGCAGAGGAGGGGAAGG + Intronic
912521102 1:110245147-110245169 AGGTCTGGCGGAGGAGGGAAGGG + Intronic
912594040 1:110856395-110856417 CACTGTGGCAGCGGAGGAGATGG - Intergenic
912905937 1:113707341-113707363 TGATATGGCAGAGGAGGAGAGGG - Intronic
913589502 1:120310014-120310036 AGGGGTGGAAGAGGACAAGATGG - Intergenic
913618684 1:120588352-120588374 AGGGGTGGAAGAGGACAAGATGG + Intergenic
914385030 1:147160412-147160434 AGATGTACCACAGGAGGAGATGG + Intronic
914503389 1:148266560-148266582 GGGTGTTGCAGCTGAGGAGATGG + Intergenic
914571524 1:148921872-148921894 AGGGGTGGAAGAGGACAAGATGG - Intronic
914601308 1:149208390-149208412 AGGGGTGGAAGAGGACAAGATGG + Intergenic
914846847 1:151288207-151288229 AGTAATGGCAGAGGAGGTGATGG - Exonic
914859260 1:151372746-151372768 GGGTGGGGCAGAGAAGGAGGAGG + Intergenic
915141499 1:153771178-153771200 GGGTGGGGCAGAGAGGGAGAGGG + Intronic
915205731 1:154269189-154269211 AACTGTGGCACAGGAGGAGAAGG - Intronic
915549245 1:156623253-156623275 GGATGTGACAGAGGAAGAGAGGG + Intronic
915586582 1:156846906-156846928 AGGGGGGGCGGAGGAGGGGAGGG + Intronic
915592810 1:156880240-156880262 GGCTGTGGCAGAGGGGCAGAAGG - Intronic
915608590 1:156971819-156971841 AGGGATGGGTGAGGAGGAGAAGG + Intronic
915940518 1:160115703-160115725 AGGCGGGGGAGAGGGGGAGAAGG + Intergenic
916349859 1:163836881-163836903 TGGTCAGGAAGAGGAGGAGAGGG - Intergenic
916426988 1:164690131-164690153 AGGGGAGGCCGAGGAGGAGCCGG - Intronic
916491318 1:165304853-165304875 AGATTTGGCAGACGAGGAGAGGG - Intronic
916881663 1:169024692-169024714 AGGGGAGGAAGAGGAGGAGGAGG + Intergenic
917231275 1:172840587-172840609 AGAGGAGGGAGAGGAGGAGAAGG - Intergenic
917262281 1:173183183-173183205 AGGGGTGGCAGAGAAAGAGGAGG + Intergenic
917597463 1:176543637-176543659 AGGTGTGGCATTGGAGATGAAGG - Intronic
917969958 1:180199977-180199999 GGGTGTGGGGGTGGAGGAGAGGG + Exonic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918107582 1:181427256-181427278 AGATGGGGCAGAGGTTGAGATGG - Intronic
918391190 1:184064439-184064461 TGGTGTGGCATGGGTGGAGAAGG + Intronic
918663459 1:187118048-187118070 AGGAGTAGCAGAAGATGAGATGG + Intergenic
918682980 1:187378362-187378384 AGGGGTCGCAGAGGTTGAGAGGG - Intergenic
918995661 1:191756168-191756190 ACCTGCGGCAGTGGAGGAGATGG - Intergenic
919178209 1:194047174-194047196 AGGTACTGCAGATGAGGAGATGG + Intergenic
919334493 1:196214595-196214617 AGGTGTGGTAAAGGAGAAGAGGG + Intergenic
919605886 1:199683362-199683384 AGCTGGGGCAGAGGTGGTGATGG + Intergenic
919989990 1:202702955-202702977 AGGTGTAGCAGAAGCAGAGAAGG + Intronic
920098281 1:203500350-203500372 AGAGGTGGCAGAGGTGGAGGTGG - Intronic
920098853 1:203504052-203504074 AGCTGTGGGAGAGGAAGAGGGGG + Intronic
920139489 1:203797642-203797664 AGATGTGGTAGAGGAAAAGATGG + Exonic
920144231 1:203844379-203844401 AGGTGAGGCAGATCAGGAGTTGG - Intronic
920220415 1:204394755-204394777 AGATGTGGAAGAAGAGGAAATGG + Intergenic
920221763 1:204409318-204409340 GGGTGAGGGACAGGAGGAGAAGG + Intronic
920307699 1:205029727-205029749 CCGTGTGGCAGAAGAGGATAAGG + Intergenic
920448462 1:206038524-206038546 GTGTGTGGCAGAGGGGGAGACGG + Intronic
920491131 1:206416234-206416256 AGTCGTGGCAGAGGAGGCGAGGG - Intronic
920513376 1:206566903-206566925 GGGTTTGACAGAGGAGGAGTGGG + Intronic
920770815 1:208883355-208883377 AGGTGCTGCAGACAAGGAGATGG + Intergenic
921151123 1:212403963-212403985 TGCTGTAGCAGAGGGGGAGAAGG - Intronic
921158902 1:212459013-212459035 GGGTGTGGCTGAGGGGGAGGAGG + Intergenic
921291773 1:213664155-213664177 GGGAGAGGCAGGGGAGGAGAAGG + Intergenic
921479290 1:215645222-215645244 AGGTTTGGCGAAGGTGGAGATGG + Intronic
921830319 1:219721297-219721319 AGGTGTGGGAGGGTGGGAGAAGG + Intronic
922058588 1:222065400-222065422 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
922181906 1:223242464-223242486 GGGTGGGGCAGTGGAGGAGTTGG - Intronic
922350907 1:224733976-224733998 AGGTGGGAAAGAGGAGGAGGGGG - Intronic
922368857 1:224890123-224890145 AGGGGTGGTAGAGTAGCAGATGG - Intergenic
922408117 1:225339903-225339925 AGGAGAGGCAGAGGAGGAAGAGG - Intronic
922516265 1:226210493-226210515 AGATGTGTCAAAGGAGAAGATGG - Intergenic
922539878 1:226410520-226410542 AGGGGTGGGAGGGGAGGGGAGGG + Intergenic
922547437 1:226468815-226468837 ATGTGTGGTTGTGGAGGAGAAGG + Intergenic
922800618 1:228363121-228363143 AGAAGAGGGAGAGGAGGAGAGGG + Intronic
923072361 1:230577620-230577642 AGGGGAGGAAGAGGAGGAGGAGG - Intergenic
923072371 1:230577659-230577681 AGGGGAGGAAGAGGAGGAGGAGG - Intergenic
923146437 1:231202016-231202038 AGTGGTGGCAGAGGAGGAGGAGG + Intronic
923290765 1:232543419-232543441 AGGGGTGACAGAGGTGGAAAAGG - Intronic
923330400 1:232918464-232918486 AGGAGTGGCAGAGGAGGAAGAGG + Intergenic
923425824 1:233868438-233868460 AGAAGTGGCAGAAGAAGAGAGGG - Intergenic
923745188 1:236693584-236693606 TGGTGTGGGAGAGGAGGAGGGGG - Intronic
924269526 1:242318361-242318383 AGGTGTGACAGCAGAGGAGTCGG - Intronic
924509018 1:244712949-244712971 ACGTGTGGGAGAGGTGAAGACGG - Intergenic
1063011284 10:2024011-2024033 AGGTGTCCCAGGGCAGGAGAAGG + Intergenic
1063031107 10:2235787-2235809 AGGAGTGGAAGAGGATGAGTAGG - Intergenic
1063081042 10:2767387-2767409 AGGTGGGGCATGGGAGCAGATGG - Intergenic
1063156251 10:3381902-3381924 AGGTGAGACAGAGCAAGAGATGG - Intergenic
1063267275 10:4467403-4467425 AGAGGAGGAAGAGGAGGAGAAGG - Intergenic
1063279142 10:4605741-4605763 AAGTGAGGGAGAGGAGTAGAAGG - Intergenic
1063693187 10:8306635-8306657 AAGTTTGCCAGAGGAGGAGGTGG + Intergenic
1063957504 10:11280622-11280644 TGGTGTGACAGAGCATGAGATGG + Intronic
1064009045 10:11720761-11720783 AGATGTGACAGAGGTGGAGGAGG - Intergenic
1064114776 10:12568348-12568370 AGGAGGGGGAGAGGAGGGGAGGG - Intronic
1064733237 10:18354721-18354743 AAGTCTGGCAGAGCAGGTGATGG + Intronic
1065045861 10:21747245-21747267 AGGTGAGGCAAAGCAGGTGAAGG - Intergenic
1065550425 10:26863836-26863858 AGGGGTGGAAGAGGAGGGGGAGG + Intergenic
1065696816 10:28388082-28388104 AGGGGTGGGAGAGGAGGGAAGGG + Intergenic
1065793027 10:29279030-29279052 AGGGGTGGCAGAGGTGGAGGAGG - Intergenic
1065837947 10:29676182-29676204 AGGTGCTGCAGGTGAGGAGATGG - Intronic
1065983259 10:30924275-30924297 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1066050086 10:31626096-31626118 AGGGGTGGAAGAGGAGTGGATGG - Intergenic
1066129748 10:32381347-32381369 AGGGGCGGCAGAGGTGGAGGAGG + Intergenic
1066199032 10:33128098-33128120 AGGAGTGGGAAAGGAGGGGAGGG - Intergenic
1066465207 10:35643776-35643798 AGGAGGGGAAGAGGAGGAGGGGG - Intergenic
1066494154 10:35925799-35925821 TGGAGAGGCAAAGGAGGAGAGGG + Intergenic
1066649236 10:37639507-37639529 AGGGCTGGCAGAGGAGGCCATGG - Intergenic
1067044088 10:42974797-42974819 AGGTGAGAGAGAGGAGCAGAGGG + Intergenic
1067118233 10:43452221-43452243 AGGTGTGGGACAGAAGGGGAGGG - Intronic
1067169046 10:43890840-43890862 ATGAGTAGGAGAGGAGGAGAAGG - Intergenic
1067184165 10:44013045-44013067 AGGAGAAGCAGAGGAGGAAAGGG - Intergenic
1067247648 10:44559719-44559741 AAGAGTGGCCCAGGAGGAGAAGG - Intergenic
1067336371 10:45368306-45368328 AGGAGTGGCTGGGGAGCAGATGG + Intergenic
1067363057 10:45600073-45600095 AGGTGTTGCAGCCAAGGAGATGG - Intergenic
1067717260 10:48699127-48699149 AGGTCTGGGAGGTGAGGAGAGGG + Intronic
1067851542 10:49758159-49758181 AGGTGTGGCTGAGCAGGACATGG + Intronic
1068296826 10:55081182-55081204 ATCTGAGGCAGAGAAGGAGATGG - Intronic
1068298162 10:55103004-55103026 AGGTGTGGCAGAGGCAGAAGAGG + Intronic
1068328640 10:55530850-55530872 AGGTCTGGCAGTGGAGCTGATGG + Intronic
1068395735 10:56458774-56458796 AGAGGAGGAAGAGGAGGAGAAGG + Intergenic
1068835212 10:61545338-61545360 AGGGGAGGAGGAGGAGGAGAAGG + Intergenic
1068948336 10:62752166-62752188 AGGTGAGGAGGAGGAGGAGGAGG + Intergenic
1069047607 10:63759589-63759611 AGGGGTGGTGGAGGAGGGGAAGG + Intergenic
1069307723 10:66992398-66992420 AGGAGTGGAGGAGGAGGAGGAGG - Intronic
1069666310 10:70162466-70162488 AGGCGGGGCAGGGGAGGAGGGGG + Intronic
1069668744 10:70183617-70183639 AGGGGAGGAGGAGGAGGAGAAGG + Intergenic
1069721850 10:70554910-70554932 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1069728350 10:70595555-70595577 TGTTGTGGCAGAGGAAAAGATGG + Intergenic
1069728629 10:70597313-70597335 TGTTGTGGCAGAGGAAAAGATGG - Intergenic
1069874621 10:71553954-71553976 AGGTCTGGAAGGGGAGGGGAAGG - Intronic
1069942339 10:71964323-71964345 GGGTGAGGAAGAGGAGGAGGAGG + Intergenic
1070326727 10:75394698-75394720 AGGTGTGGCAGAGTCAGAGCAGG + Intergenic
1070572609 10:77651276-77651298 GGATGAGGCAGGGGAGGAGAGGG + Intergenic
1070688759 10:78509397-78509419 GGGTATGGCAGAGGATGACACGG - Intergenic
1070973693 10:80588134-80588156 AGGTGCTGCAGCTGAGGAGATGG + Intronic
1071073517 10:81724712-81724734 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1071259111 10:83903482-83903504 AGGTGTGAGAGAGGAGAAAAAGG - Intergenic
1071399659 10:85256895-85256917 GGGACTGGCAAAGGAGGAGATGG - Intergenic
1071877777 10:89861378-89861400 AGGAGTGGAAGAGGAGGAGGAGG - Intergenic
1072733315 10:97862892-97862914 AAGTGTGGCAGCTAAGGAGATGG + Intronic
1072755320 10:98016864-98016886 GGGAGTGTCAGAGGAGGAGGGGG + Intronic
1073139727 10:101239101-101239123 GGGTGTGGCAGGGGAGAGGAAGG - Intergenic
1073261272 10:102192402-102192424 ACCTGAGGCACAGGAGGAGAGGG + Intergenic
1073727653 10:106252914-106252936 AGGACTGGCAGTGGAGGAGCAGG + Intergenic
1074195896 10:111185013-111185035 AGGGGTGGCAGAGGTGGAGAAGG - Intergenic
1074204455 10:111270758-111270780 AGGAAAGGCAGAGGAGGAGGAGG - Intergenic
1074363157 10:112838692-112838714 GGGGGTGGCAGAGAAGGAGCAGG + Intergenic
1074377091 10:112949930-112949952 CGGGGTGGGAGAGGAGGAGAAGG - Intergenic
1074820486 10:117174691-117174713 AAGCCTGGCAGAGGAGGGGAGGG + Intergenic
1075282540 10:121152736-121152758 CGCTGGGGAAGAGGAGGAGAAGG - Intergenic
1075575131 10:123572505-123572527 AGGAGAGGAAGAGGAGGAGGAGG + Intergenic
1075588054 10:123671521-123671543 AGGTGTGGCTGAGTGGGGGAGGG - Intronic
1075873722 10:125789517-125789539 CGGTTTGACAGATGAGGAGATGG - Intronic
1076163444 10:128263519-128263541 AAGAGGGACAGAGGAGGAGAGGG - Intergenic
1076197845 10:128532851-128532873 AGGTCTGTCATGGGAGGAGATGG + Intergenic
1076317282 10:129551416-129551438 AGGTGGGGCAGAGGGAGGGATGG + Intronic
1076369044 10:129940218-129940240 AGGTGAGGAGGAGGAGGGGAAGG - Intronic
1076758209 10:132586230-132586252 AGGTGGGGGAGACGTGGAGAAGG - Intronic
1076767178 10:132642584-132642606 CGGAGTGACAGGGGAGGAGAGGG - Intronic
1076795416 10:132795658-132795680 AGGGATGGCAGAGGCCGAGAGGG - Intergenic
1077234297 11:1472501-1472523 AGCTGGGGCAGTGGAGGCGATGG - Intronic
1077252951 11:1568676-1568698 AGGTAGGGCAGAGGAGCGGAGGG - Intronic
1077317331 11:1925340-1925362 GGGTGGGGGAGAGGGGGAGAGGG + Intronic
1077838657 11:5947994-5948016 AGGTGTAGGAGAGGAAGATAAGG - Exonic
1078187199 11:9062089-9062111 AGGAATAGCAGAGGAGGAGAGGG + Intronic
1078484637 11:11710280-11710302 AGCTGGGACTGAGGAGGAGAAGG + Intergenic
1078667668 11:13339866-13339888 AGGTGTGCCAGATGAGGACAAGG + Intronic
1078777824 11:14410074-14410096 AGGTGGGGCAGAGCTGGAGCAGG + Intergenic
1078868233 11:15318672-15318694 AGGTGTGGAATAGGAGAAGCTGG + Intergenic
1078924517 11:15861878-15861900 AGGTGTGGCAGGTGATGAGGAGG + Intergenic
1079079522 11:17404586-17404608 AGGTGTGACATAGGAGATGACGG + Exonic
1079348259 11:19671577-19671599 AGGTGGGGCAGAGGAGCTAAGGG - Intronic
1079457704 11:20651245-20651267 GGGTGGGGGAGAGGAGGGGAGGG - Intronic
1079892878 11:26079952-26079974 AGGAGAGGGAGAGGGGGAGAGGG + Intergenic
1079893986 11:26095510-26095532 AGGTGTAGAAGAGAAAGAGACGG + Intergenic
1080202624 11:29690712-29690734 AGGAGGAGCAGAGGAGGAGAAGG + Intergenic
1080865598 11:36191906-36191928 ATGTGTGGCAGTGGCAGAGATGG + Intronic
1080888778 11:36390309-36390331 AGGTGGGGCAGAGCAGGTGCTGG + Intronic
1081362904 11:42202014-42202036 ATGTGTGGCTCAGGAAGAGAAGG + Intergenic
1081858262 11:46317277-46317299 TGGTTTGGGAGAGGAGGAGTGGG + Intronic
1082009064 11:47438219-47438241 CCCTGGGGCAGAGGAGGAGAGGG - Intronic
1082841777 11:57695971-57695993 AGGTCTGGCTTAGGAGGAGGTGG - Exonic
1082960438 11:58914217-58914239 AGGTGTGGAATTGGATGAGAGGG - Intronic
1083587759 11:63872858-63872880 AAGTGGGGGAGAGGAGGAGGAGG - Intronic
1083613109 11:64013794-64013816 AGGCCTGGAAGTGGAGGAGAGGG - Intronic
1083828155 11:65214603-65214625 AGGAGGGGCAGAGCAGGAAAGGG - Intergenic
1083837224 11:65278812-65278834 TGGTCTGGGAGAGGAGGAGCTGG + Exonic
1083853518 11:65380868-65380890 AGGTGGGGCAGAGGCCCAGAGGG + Intronic
1083931872 11:65850621-65850643 AGGGGTGGCAGGGCTGGAGAAGG + Intronic
1084476080 11:69390561-69390583 AGGGGAGGGAGAGGAGGAGGAGG + Intergenic
1084485819 11:69447574-69447596 AGGTGAGGCAGAGGGGCACATGG - Intergenic
1084493115 11:69488945-69488967 AGGTGTGGCAGAGGTGGCTTTGG - Intergenic
1084859471 11:72008891-72008913 AGCAGTGGCCTAGGAGGAGAGGG + Intronic
1084931657 11:72561104-72561126 AGGAATGGCAGGGGAGGAGGGGG + Intergenic
1084960435 11:72713431-72713453 AAGGGTGGCAGAGGAGAAGCTGG + Intronic
1085127278 11:74010420-74010442 GGGTAGGGCAGAGGAGGAGTAGG + Intergenic
1085217994 11:74849069-74849091 AGCTGAGGCTGAGGAGGAGAGGG - Intronic
1085351250 11:75799218-75799240 AGGTGTGGCTGGGGAGGGGCTGG + Intronic
1085362484 11:75903073-75903095 AGGTGGGGAGGAGGAGGAGAAGG - Intronic
1085378311 11:76088448-76088470 GGGGGTGGCATAGGAGAAGATGG - Intronic
1085383565 11:76142091-76142113 GGGTATGGCAGAGGAGGGGAAGG - Exonic
1087079632 11:94157375-94157397 AGGTGCGGGAGAGGAGGTGGAGG - Intronic
1087203734 11:95372415-95372437 AGGAGAGGAAGAGGAGGAGAAGG + Intergenic
1087892358 11:103550062-103550084 AGGTCACACAGAGGAGGAGAAGG - Intergenic
1088687928 11:112300167-112300189 GGGTCTGGCAGATGATGAGATGG - Intergenic
1089200830 11:116723858-116723880 AGGTTTGGGGGAGCAGGAGAGGG - Intergenic
1089287166 11:117415004-117415026 AGGTTTTGCAGTAGAGGAGACGG + Intergenic
1089297820 11:117480575-117480597 GGGTGCGGCAGTGGAGGGGAGGG + Intronic
1089314008 11:117578311-117578333 AGGTGTGGCAGTGAGGGAGAAGG - Intronic
1089555693 11:119315049-119315071 AGGAGACACAGAGGAGGAGAAGG + Intronic
1089588375 11:119524214-119524236 AGGTGAGGGAGCGGAGGAGAGGG + Intergenic
1089609927 11:119663452-119663474 AGGGGTGGCTGAGCAGGAGGTGG + Exonic
1089628134 11:119764686-119764708 GGGTGGGGCAGGGCAGGAGAAGG + Intergenic
1089767314 11:120777358-120777380 AGGTTTCACAAAGGAGGAGATGG - Intronic
1090246137 11:125217218-125217240 AGGAGTGGGAAAGGAGGGGATGG - Intronic
1090451352 11:126809165-126809187 AGGGGTGGCAGAGCAGAGGAGGG + Intronic
1090452540 11:126819429-126819451 AGGTGTGGAGGAGCAGGAGTGGG + Intronic
1091070478 11:132558329-132558351 AGGAGGGGGAGAGGAGGAGGGGG - Intronic
1091070495 11:132558362-132558384 AGGAGGGGAAGAGGAGGAGGAGG - Intronic
1091268529 11:134289365-134289387 AGGGGTGGCAGAAGAGGTGGAGG + Intronic
1091407053 12:215529-215551 AGCTGTGGCACAGTAGGACATGG + Intergenic
1091602687 12:1927682-1927704 AGCTGAGGCTGAGGAGGACAAGG + Intergenic
1091991847 12:4961857-4961879 AGGTGGGGAAGAGGAGGAAGGGG + Intergenic
1092002449 12:5043815-5043837 AGGAGGGGGAGAGGAGGGGAAGG + Intergenic
1092071692 12:5636695-5636717 AGGAGAGGCACAGGAGGAAAGGG + Intronic
1092280041 12:7091744-7091766 GGCTGTGGCAGGGGATGAGACGG + Intronic
1093180983 12:15966722-15966744 AGGGATGACAGAGGAGGTGAAGG - Intronic
1093245791 12:16734608-16734630 AGTTGTGGCATTAGAGGAGATGG - Intergenic
1093948077 12:25133563-25133585 AGGTGTGCCAGGGCAGGAGGGGG - Intronic
1094083752 12:26566109-26566131 AGGAGAAGGAGAGGAGGAGAGGG + Intronic
1094122466 12:26988829-26988851 AGGGGTGGCAGAGGTGGAAGGGG - Intronic
1094142465 12:27195246-27195268 AGATGGGAGAGAGGAGGAGAGGG + Intergenic
1094165243 12:27436499-27436521 GGGTCTAGCAGAAGAGGAGAGGG + Intergenic
1095526240 12:43129283-43129305 TGGAGTGGAAGAGGAGGGGAAGG + Intergenic
1095658096 12:44695078-44695100 GGGAGGGGCAGAGGAAGAGAGGG + Intronic
1096104248 12:48987217-48987239 GGGTTTGGAAGAGGAGGGGAGGG - Intergenic
1096180944 12:49550024-49550046 GGGAGTGGCAGAAGAGGAGGTGG - Intronic
1096238041 12:49943095-49943117 AGGTGTGGCAAAGGAAGGGCAGG + Intergenic
1096590637 12:52656836-52656858 TGGTGTGGGAGAGCAGGTGAGGG - Intergenic
1096609914 12:52794365-52794387 ACTTGTAGCAGAGGAGCAGAGGG + Intronic
1096675133 12:53221978-53222000 AGGGGTGCCAGAGTAGGCGAGGG + Intronic
1096695582 12:53346070-53346092 AGGGATGGGGGAGGAGGAGAGGG + Intergenic
1096712099 12:53465077-53465099 AGGAGTGGGAGAGGGGAAGAGGG - Intronic
1096864727 12:54555756-54555778 AGATGAGGCAAAGGAGAAGATGG - Intronic
1097185698 12:57195201-57195223 AGGTCTAGCAGTGGAGGTGATGG - Intronic
1098510907 12:71313056-71313078 AGTTGGGACAGAGGAGGAGCAGG - Intronic
1099009802 12:77278148-77278170 ATGTGTGGCTGAGGTGGAGATGG + Intergenic
1099010485 12:77285426-77285448 AGGAGTAGAAGAGGAGGACAAGG + Intergenic
1099186160 12:79517456-79517478 GGGAGAGGAAGAGGAGGAGACGG + Intergenic
1099288031 12:80739491-80739513 AGGGGTGGCAGAGGTGGAGACGG + Intergenic
1100256295 12:92886530-92886552 AGGGGAGGGAGAGGAGGGGAGGG + Intronic
1100457779 12:94768845-94768867 AAGGCCGGCAGAGGAGGAGAAGG - Intergenic
1100735123 12:97520225-97520247 AGGTTTGGCTGTGGAGGAGCAGG + Intergenic
1100912807 12:99384620-99384642 AGGGGAGGGAGAGGAGGGGAAGG - Intronic
1101038894 12:100733923-100733945 GGGGGTGGCTGGGGAGGAGAGGG + Intronic
1101673244 12:106896477-106896499 AGGGGAGGAAGAGGAGGGGAGGG + Intergenic
1101731020 12:107426790-107426812 AGAGGTGGGAGAGGAGGGGAGGG - Intronic
1102260820 12:111442409-111442431 AGGTGTGGCAGAGGCGTGGCTGG + Intronic
1102444869 12:112994275-112994297 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1102721537 12:115020808-115020830 GGGGCTGGCATAGGAGGAGAAGG + Intergenic
1102745184 12:115243816-115243838 AGGAGAGGGAGAGGAAGAGAGGG + Intergenic
1102745224 12:115243946-115243968 AGGAGAGGCAGAGGAAGGGAAGG + Intergenic
1103524807 12:121560644-121560666 AGTGGGGGCAGAGGAAGAGACGG + Intronic
1103564656 12:121809658-121809680 GGGGGTGACAGAGGAGGAGCCGG - Exonic
1103615553 12:122149420-122149442 TGGTGGGGCAGGGGAGGAAAGGG + Intergenic
1103969082 12:124658523-124658545 AGATGAGGCAGAGAGGGAGAGGG + Intergenic
1104036955 12:125104305-125104327 AGGTGGAAGAGAGGAGGAGATGG + Intronic
1104125386 12:125841202-125841224 AGATGCTGCAGTGGAGGAGATGG + Intergenic
1104178751 12:126357791-126357813 AGGGGAGGGAGGGGAGGAGAGGG + Intergenic
1104636971 12:130443729-130443751 TAGTTTGGCATAGGAGGAGATGG + Intronic
1104639448 12:130458073-130458095 AGGAGGGGCGGAGGAGGGGAGGG - Intronic
1105304903 13:19161504-19161526 AGGTGAGGCAGAGGGAGAGAAGG + Intergenic
1105402255 13:20105943-20105965 AGGGATGGCAGTGGAGGGGAAGG - Intergenic
1107028776 13:35830036-35830058 CTGTGGGGTAGAGGAGGAGAAGG + Intronic
1107106615 13:36650027-36650049 AGGAGCAGAAGAGGAGGAGAAGG + Intergenic
1107269195 13:38594348-38594370 AAGTGTGGGAGAGGAGAAGATGG - Intergenic
1107897137 13:44976383-44976405 AGGTGAGGAGGAGGAGGAGAAGG + Intronic
1108192773 13:47959467-47959489 AGGAGGGGCGGAGGAGGAGGGGG + Intronic
1108246264 13:48517358-48517380 AGGAGTTACAGAGGATGAGATGG - Intronic
1108492693 13:50997225-50997247 AGGAGTAGAAGTGGAGGAGATGG - Intergenic
1108781131 13:53835532-53835554 AGGGGTAGCAGAGGTGGAGGAGG - Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1108855621 13:54789379-54789401 AGGTGCTGCAGCTGAGGAGACGG + Intergenic
1110142401 13:72146972-72146994 ATGTGTGGCAGGAGAGGTGATGG - Intergenic
1110314255 13:74086966-74086988 GGGTGAGGAAGAGGAGGAGTTGG + Intronic
1111430385 13:88142377-88142399 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1111929338 13:94497732-94497754 AGGGGTGGCAGAGGTGGAAGAGG + Intergenic
1112375491 13:98836222-98836244 TGGTGGGGCACAGGAGGAGAGGG + Intronic
1112506936 13:99981149-99981171 AGTTGTGCCGGAGGAGGAGGCGG - Intergenic
1112834617 13:103498945-103498967 AGGTGAGGAAGAGGAAGAGAAGG - Intergenic
1112966585 13:105203936-105203958 AGGGGTGGGAGGGTAGGAGAGGG + Intergenic
1113067727 13:106388902-106388924 ATTTGTGACAGATGAGGAGAAGG - Intergenic
1113575143 13:111390058-111390080 AGGAGCGGCAGGGGAGCAGAAGG - Intergenic
1113748421 13:112762184-112762206 AGCTGGGGCAGAGGAGGAGGAGG - Intronic
1113768273 13:112894157-112894179 ATGGGTGGGAGAGGGGGAGAGGG + Intergenic
1113909801 13:113836538-113836560 AGGGGTGGGGGAGGAGGTGAGGG + Intronic
1114127131 14:19741612-19741634 TGGTGAGGAAGAGGAGAAGAGGG + Intronic
1114267666 14:21082208-21082230 AGGAGTGGCAGAGGAGGTGTGGG - Intronic
1114317674 14:21523291-21523313 ATCTGGGGCAGAGGAGGAGGTGG - Exonic
1114390266 14:22300472-22300494 AGGTGTGGCAGTGGTGCAGAGGG - Intergenic
1114483575 14:23049562-23049584 AGGGGTGGAGGAGGAGGAGAAGG + Intronic
1114666597 14:24380994-24381016 AGCTGGTGAAGAGGAGGAGATGG + Intergenic
1115022122 14:28694618-28694640 AAATGTGGAAGAGGAAGAGATGG - Intergenic
1115401725 14:32969151-32969173 TGGTGTGGCCTAGGAGGTGAGGG - Intronic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1115691397 14:35847718-35847740 AGGTGTGGCGGAGGGGGAAATGG - Intronic
1116350636 14:43857861-43857883 AGGTTTCGCAAAGGAGGGGATGG - Intergenic
1117157192 14:52952050-52952072 AGGTGTGGCTGAGGGTGGGATGG - Intronic
1117500878 14:56350113-56350135 AGGTGGGGAGGAGGAGGAGGAGG + Intergenic
1117509419 14:56434016-56434038 GGGTGTAGCAGAGGTGGGGATGG - Intergenic
1118717886 14:68573262-68573284 AGGTGGGGTAGAGAAGGAGCAGG - Intronic
1118735808 14:68701187-68701209 AGGTGTGACAGAAGATGAGCTGG - Intronic
1118882720 14:69842759-69842781 AGGTGGGGAGGAGAAGGAGAAGG + Intergenic
1118970243 14:70630386-70630408 AGGCGTGGCAGAGGAAGAAGTGG - Intergenic
1118979089 14:70701657-70701679 AGGAGGGGATGAGGAGGAGAAGG + Intergenic
1119092396 14:71796808-71796830 AGGGGTGGCAGAGGTGGAAGAGG - Intergenic
1119118171 14:72046563-72046585 AGGGGAGGAAGAAGAGGAGATGG - Intronic
1119510246 14:75205646-75205668 ACTTGTGGCAGAGGAGGTGGAGG - Intergenic
1119622714 14:76144790-76144812 AGGCGTGGCAAGGGAGGAGTTGG + Intergenic
1119888496 14:78164456-78164478 AGGAGAGGCGGAGGCGGAGATGG + Intergenic
1120678008 14:87444192-87444214 AGAAGTGGAAGAGGAGGAGGAGG - Intergenic
1121173824 14:91875667-91875689 AGGGCTGGCAGGGGAGGAGCAGG - Intronic
1121742865 14:96266303-96266325 AAGGATGGCAGAGGAGGAGGCGG + Intronic
1121743184 14:96268172-96268194 AGGTGAGGAAGAGGAGGCTAAGG + Intronic
1122036119 14:98950448-98950470 AGGGGAGGGAGAGGAGGGGAGGG + Intergenic
1122093568 14:99355151-99355173 AAGTGTGGGAGTGGAGGACATGG - Intergenic
1122254174 14:100464604-100464626 GGGTGTGGGAGATGAGGAGAGGG - Intronic
1122425437 14:101602697-101602719 AGGGAGGGAAGAGGAGGAGATGG + Intergenic
1122426334 14:101608086-101608108 AGGTGGAGTAGAGGAGGAGGAGG - Intergenic
1122832535 14:104407083-104407105 AGTTCTGGCAGAGCAGGAAATGG + Intergenic
1123071336 14:105643942-105643964 AGGTGGTGCTGAGGAAGAGATGG + Intergenic
1124062262 15:26305427-26305449 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124062838 15:26310653-26310675 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124375914 15:29128515-29128537 AAGTGGGGCAGAGGAAGACAAGG + Intronic
1124420753 15:29519379-29519401 CGGGGTGGCAGAGGAGGAAGAGG - Intronic
1124437746 15:29665065-29665087 AGGTGTGGGAGAGGATGGGAGGG - Intergenic
1125267576 15:37900840-37900862 AGGTGAGGGAGAGAAGGGGAAGG - Intergenic
1125423489 15:39527450-39527472 AGGGGTGGCAGAGGAGGACGAGG - Intergenic
1125469762 15:39991212-39991234 AGGAGTGGAAAGGGAGGAGAGGG + Intronic
1125594564 15:40876063-40876085 AGGGGTGGCAGAGGTGGAGAAGG + Intergenic
1125838701 15:42777718-42777740 AGCTGAGGCAGAGGAGAAGGAGG + Intronic
1125920760 15:43524281-43524303 AGCTGTGGAAGAGGAAGAGGAGG + Exonic
1126067826 15:44839427-44839449 GGGTGTGGCACAGAAGAAGATGG + Intergenic
1126275511 15:46874890-46874912 AGGGGTGGGAGAGAAGGGGATGG + Intergenic
1126362803 15:47863597-47863619 AGGAGAGGAAGAAGAGGAGAAGG + Intergenic
1126424962 15:48517317-48517339 TGGTGTGGAAGGGGAAGAGAAGG + Intronic
1126648917 15:50902185-50902207 AGGGCTGCCAGATGAGGAGATGG - Intergenic
1128139751 15:65290765-65290787 AGGAGTGGCAGAGGAGGAAGAGG - Intronic
1128185149 15:65638317-65638339 GGGTGAGGCAAGGGAGGAGAGGG + Intronic
1128290830 15:66477098-66477120 AGGGGTTGGAGAGGAGGAGAAGG - Intronic
1128613669 15:69093207-69093229 AGGTGGGGCAGAGGGAGAGGTGG + Intergenic
1128633374 15:69287344-69287366 AGGAGTGTCAGTGAAGGAGACGG - Intergenic
1128682710 15:69663173-69663195 AGGTGTGGTAGTGGAAGAGTCGG + Intergenic
1129119034 15:73383887-73383909 ACTTGTGGCAGAGGAGGAAGAGG + Intergenic
1129167578 15:73787463-73787485 GGCTGGGGCAGAGGAGCAGATGG + Intergenic
1129186024 15:73907099-73907121 AGAAGAGGAAGAGGAGGAGAAGG - Intergenic
1129325177 15:74796362-74796384 AGAGGTGGCAGAGGTGGAGGCGG + Intronic
1129345017 15:74911947-74911969 GTGGGAGGCAGAGGAGGAGATGG + Intergenic
1129816697 15:78561689-78561711 AGGCAAGGCAGAGGAGGAGGAGG + Intergenic
1130009205 15:80135058-80135080 AGGGTTAGCAGAGGTGGAGAAGG - Intronic
1130027556 15:80283020-80283042 AGCTGTGGCAGAGGTGTGGATGG - Intergenic
1130332950 15:82935449-82935471 AGGGCAGGCAGAGAAGGAGAGGG - Intronic
1130512987 15:84604392-84604414 TGGTGTTTCGGAGGAGGAGAAGG + Intronic
1130558529 15:84940929-84940951 AGATGTGGCAAAGGCGGACAAGG - Intronic
1130710379 15:86274934-86274956 AGGTGGGGAAGAGCAGGAGGTGG - Intronic
1131184442 15:90263004-90263026 AATTGTGGAAGAGGAGGAGCTGG + Exonic
1131394913 15:92078490-92078512 TGGTGTGGCTGTGTAGGAGATGG - Intronic
1131446147 15:92499556-92499578 AGGGGAGGCAGAGGAGGAGGGGG - Intronic
1131603086 15:93870101-93870123 AGGTGAGACAGAGAGGGAGAGGG + Intergenic
1131701651 15:94943042-94943064 AGGGGGGAGAGAGGAGGAGAAGG + Intergenic
1131712818 15:95074375-95074397 AGGTGTAGCTGAGGTGGAGGTGG + Intergenic
1131912548 15:97224237-97224259 AGGTGTGGCGGAAGAGGCGCGGG + Intergenic
1132493825 16:250304-250326 AGGGCTGGAAGAAGAGGAGACGG - Intronic
1132598506 16:763786-763808 AGGTGGAGCAGAGGAGGAAGGGG - Intronic
1132953043 16:2575574-2575596 AGGTGTGGCAGAGGAATCGAGGG + Intronic
1132961308 16:2624594-2624616 AGGTGTGGCAGAGGAATCGAGGG - Intergenic
1133316972 16:4890923-4890945 TGGCGGGGCAGAGGAGGAGACGG + Intronic
1133440736 16:5818994-5819016 AAATGGAGCAGAGGAGGAGAAGG - Intergenic
1133485529 16:6215098-6215120 AGGAGAGGGAGAGGAGTAGAGGG + Intronic
1133905330 16:10016901-10016923 AGATTTGGCAGAGGAGGTGTAGG - Intronic
1134410515 16:14000035-14000057 AGAGGAAGCAGAGGAGGAGAGGG + Intergenic
1134692014 16:16197397-16197419 AGGATTGGAGGAGGAGGAGAAGG + Intronic
1134842828 16:17415240-17415262 ATGTGTTGCAGTGGAGGGGAGGG - Intronic
1135212723 16:20537653-20537675 ATGATTGGCAGAGGAGGAGCTGG - Intronic
1135359202 16:21796893-21796915 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135457754 16:22613330-22613352 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135700564 16:24628486-24628508 AGATGTGGCAGAGGTGGAGAAGG - Intergenic
1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG + Intronic
1135921340 16:26651449-26651471 AGGTGATGCAGCTGAGGAGATGG + Intergenic
1136366212 16:29810409-29810431 AGGTCTGACAGAAGAGGAGCAGG - Exonic
1136712795 16:32253765-32253787 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136755121 16:32675664-32675686 GGGTGGGGCTGAGGAGGAGGCGG + Intronic
1136812992 16:33194705-33194727 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136819468 16:33304785-33304807 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136826031 16:33361320-33361342 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136831097 16:33460091-33460113 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136930118 16:34410922-34410944 AGATGTGGCAGAGGAGGGAGAGG - Intergenic
1136974456 16:35000883-35000905 AGATGTGGCAGAGGAGGGAGAGG + Intergenic
1137277311 16:46944366-46944388 AGAAGAGGCAGAGGAGGAGGAGG + Intergenic
1137551412 16:49440135-49440157 GGATGGGGCAGAGAAGGAGATGG - Intergenic
1137572931 16:49578576-49578598 AGGTGGGAGAGAGAAGGAGAGGG - Intronic
1137617502 16:49856240-49856262 AGGGGCGGAGGAGGAGGAGAAGG - Intronic
1137859330 16:51830494-51830516 AGAGGAGGAAGAGGAGGAGAAGG - Intergenic
1138421608 16:56902774-56902796 AAGTGTGGAGGAGGAGGAGGAGG - Intronic
1138609734 16:58113317-58113339 AGGAGGGGAAGAGGAGGAGGTGG + Intergenic
1139164103 16:64545863-64545885 AGGTGTAGTCCAGGAGGAGAAGG - Intergenic
1139209938 16:65067679-65067701 AGGTGAGACAGAGAAAGAGAAGG + Intronic
1139334232 16:66219884-66219906 CTGTGTGGCAGGGGAGGACAGGG + Intergenic
1139411656 16:66766455-66766477 GGGTGTGAAGGAGGAGGAGAAGG + Intronic
1139424910 16:66873643-66873665 AGGAGAAGAAGAGGAGGAGAAGG - Intergenic
1139475168 16:67199426-67199448 AGGTGGGGCAGTGGGGCAGATGG - Intronic
1139520270 16:67478709-67478731 AGGTGGGGCAGAGGGCGGGAGGG + Intronic
1139676294 16:68526258-68526280 AGGGATGGGAGAGGAGGAGATGG - Intergenic
1139681942 16:68571884-68571906 AGGGAGGGCAGAGGAGCAGAGGG + Intronic
1140291292 16:73660480-73660502 AATTGTGGCAGAGAAGGAGCAGG - Intergenic
1140571991 16:76118431-76118453 ATGTGTGTCAGAGAAGGACAAGG - Intergenic
1140673486 16:77303062-77303084 AGGGGAGGAAGAGGAGGATACGG - Intronic
1140768867 16:78185022-78185044 TGTTGTGACAGAGGAAGAGAGGG + Intronic
1140773320 16:78226525-78226547 AGGAGAGGAGGAGGAGGAGAAGG - Intronic
1141148277 16:81547156-81547178 ATCTGGGGCAGAGGAGGAGAGGG + Intronic
1141153318 16:81579583-81579605 AGGTGTGGAAGAGGTAGAGGGGG + Intronic
1141622017 16:85241373-85241395 AGGTGGGGCAGAGACAGAGAGGG - Intergenic
1141625727 16:85260039-85260061 AGATGAGGCAGTGGAGGAGGGGG + Intergenic
1141891755 16:86930865-86930887 AGGGGATGAAGAGGAGGAGAAGG - Intergenic
1141894901 16:86953153-86953175 TGGAGTGACAAAGGAGGAGATGG - Intergenic
1141917262 16:87107927-87107949 AGGCATGGCAGAGGATCAGAGGG - Intronic
1141948345 16:87325070-87325092 AGGTGAGGCGGAGGCCGAGAGGG - Intronic
1141998395 16:87649051-87649073 GGGTGTGGCAGTGGAGACGAGGG + Intronic
1141999817 16:87657900-87657922 TGCTGTGGGAGAGGAGGAGCTGG + Intronic
1142157883 16:88540917-88540939 AGGAGTGTCAGAGAAGGGGAGGG - Intergenic
1142225926 16:88877665-88877687 GGGTGGGGCAGAGGTGGGGAGGG - Intronic
1142287771 16:89178377-89178399 TGATGTGGGAGAGGAGGAGATGG + Intronic
1202991569 16_KI270728v1_random:17675-17697 GGGTGGGGCTGAGGAGGAGGCGG - Intergenic
1203057263 16_KI270728v1_random:936003-936025 GGGTGGGGCTGAGGAGGAGGCGG + Intergenic
1142608037 17:1092784-1092806 AGGTGTGGCAGGGAAGGGCAGGG + Intronic
1143082920 17:4394750-4394772 AGATGGGCCAAAGGAGGAGAAGG - Intergenic
1143098985 17:4494564-4494586 AGATGTGGCTGTTGAGGAGAAGG + Intergenic
1143155599 17:4834033-4834055 AGCTGAGGAAGAGGAGGGGAAGG - Intronic
1143165879 17:4897102-4897124 AGGGGTGGCAGAAGAGTTGAGGG - Intronic
1143244133 17:5468720-5468742 AGCGGCGGCAGAGGAGGAGGAGG - Exonic
1143284907 17:5781719-5781741 AGTGGTGGCAGAGGTGGCGACGG + Intronic
1143383544 17:6510968-6510990 GGGGGTGGAAGAGGAGGGGAGGG + Intronic
1143651638 17:8267138-8267160 CTGTGTGGCAGAGGAGGAACGGG + Exonic
1144110591 17:12027773-12027795 GGTTGTGGCAGAGGTGTAGAGGG + Intronic
1144465664 17:15495020-15495042 AGGAGAGACAGAGGAGGGGATGG + Intronic
1144478713 17:15611577-15611599 AGGTGACACAAAGGAGGAGACGG - Intronic
1144554186 17:16267331-16267353 AGGGGTGGCAGAGGCGGAAGAGG + Intronic
1144580428 17:16456043-16456065 GGGGGAGGGAGAGGAGGAGAAGG + Intronic
1144748487 17:17632055-17632077 AGGGGAGGAAGAGGAGAAGAGGG + Intergenic
1144919588 17:18752154-18752176 AGGTGACACAAAGGAGGAGACGG + Intronic
1144966303 17:19078805-19078827 AGAAGAGGCAGAGGAGGAGGGGG - Intergenic
1144981615 17:19173252-19173274 AGAAGAGGCAGAGGAGGAGGGGG + Intergenic
1144986609 17:19204987-19205009 AGAAGAGGCAGAGGAGGAGGGGG - Intergenic
1145388636 17:22437372-22437394 AGATCTGGTAGAGGAGGAGCAGG - Intergenic
1145936356 17:28717150-28717172 GGGTGTGGGCGAGGAGGAGGCGG - Intronic
1145959730 17:28880368-28880390 AGGAGAGGAAGAGGAGGAGGTGG + Exonic
1146273355 17:31498626-31498648 TTCTGTGGCAGAGGAGGAGCTGG + Intronic
1146320966 17:31846105-31846127 GGCTGTGGCAGCAGAGGAGAAGG - Intergenic
1146670845 17:34736489-34736511 AGGAGAGGGAGAGGAGGAGAGGG + Intergenic
1146820958 17:35983449-35983471 TGTTGTTGCTGAGGAGGAGACGG + Intronic
1147311212 17:39597065-39597087 GGGTGGGGCAGAGGTCGAGAAGG - Intergenic
1148102859 17:45103310-45103332 AAGTGGGGCAGAGGGGGAGAAGG - Intronic
1148119170 17:45197625-45197647 AGGTGGAGGAGAGGAGGAGGAGG + Intergenic
1148189067 17:45666341-45666363 AGCTGGGGGAGAGGAGGAGCAGG - Intergenic
1148200459 17:45746749-45746771 AGGGGTAGGAAAGGAGGAGAAGG - Intergenic
1148606011 17:48929345-48929367 AGGATAGGCAGAGGAAGAGATGG + Exonic
1148853138 17:50564468-50564490 AGGGGGGCCAGAGGGGGAGAGGG + Intronic
1148858794 17:50593416-50593438 CTGAGTGGCAGAGGAGGGGAGGG - Intronic
1148953667 17:51335936-51335958 AGGTGGGGCTGAGGGGGTGAAGG + Intergenic
1149273170 17:55004742-55004764 AGGCGGGGAGGAGGAGGAGAAGG + Intronic
1149500798 17:57150898-57150920 AGGTAGAGCAGGGGAGGAGACGG - Intergenic
1149696995 17:58623825-58623847 GGGGGAGGCAGAGGAGGAGGAGG + Intronic
1149778515 17:59377742-59377764 AGGTGTGGGAGAGGAGCTTATGG + Intronic
1149991176 17:61384438-61384460 ATCTGTGGCACAGGAGGGGAGGG - Intronic
1150225653 17:63523236-63523258 AGGTGGGGCAGGGGTGGGGAGGG + Intergenic
1150321936 17:64222004-64222026 TGGGCTGGCAGAGGAGGAAATGG + Intronic
1150433742 17:65138944-65138966 AGGGGTGGCTGGGGAGGAGGAGG - Intronic
1150627231 17:66849336-66849358 GGGAGGGGCAGAGGAGGAGGAGG + Intronic
1150905026 17:69327540-69327562 GGGCGAGGCAGATGAGGAGAGGG - Intergenic
1151181188 17:72329810-72329832 CTGTGTTCCAGAGGAGGAGAAGG + Intergenic
1151235931 17:72719822-72719844 GGCAGTGGCAGAGGAGGAAAGGG + Intronic
1151322532 17:73360431-73360453 GGGGTGGGCAGAGGAGGAGATGG + Intronic
1151362076 17:73595198-73595220 AGGTGAGGAGGAGGAGGAGGAGG + Intronic
1151462055 17:74260322-74260344 TGCTGTGGCAGAGGAGCAGCTGG + Exonic
1151496270 17:74460019-74460041 AGATGTCACAGAGGAGGAAATGG - Intergenic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1152145692 17:78567397-78567419 AGGTGTGAATGAGGAGGAGCTGG + Intronic
1152266289 17:79296871-79296893 AGAAGAGGGAGAGGAGGAGAAGG - Intronic
1152344684 17:79743819-79743841 AGGTGTTGGAGAGGGGGAGCTGG - Intergenic
1152447365 17:80353588-80353610 AGAGGTGGCAGAGGAGGCCATGG + Exonic
1152565121 17:81096920-81096942 AGCTGTGGAGGAGGAGGAGGTGG + Intronic
1152774409 17:82191539-82191561 TGGAGTGGCAGAGGTGGAGGAGG - Intronic
1153237729 18:3004691-3004713 AGGTGTTGGGGAGGAGGAAATGG - Intronic
1153521581 18:5959273-5959295 AGGTGAGGCAGAGCAAGAAAAGG - Intronic
1153680659 18:7497409-7497431 GGGGGAGGAAGAGGAGGAGAAGG + Intergenic
1153873361 18:9341625-9341647 AAGTGTGGCAGGGCAGGAGTGGG - Intronic
1154194162 18:12253965-12253987 GGGTGGGGCAGGTGAGGAGACGG - Intergenic
1154384010 18:13877256-13877278 AATTGTGGCAGTGGAGGGGAAGG - Intergenic
1155066655 18:22274128-22274150 AGGAGAGGAAGAGGAGGAGGAGG - Intergenic
1155076770 18:22364266-22364288 AGGGGTGGCAGAGGCGGAAGAGG - Intergenic
1155355715 18:24951415-24951437 TGGTGTGGCAGAGGGTGAGCTGG + Intergenic
1155427986 18:25726007-25726029 ATGTGCAGCAGATGAGGAGACGG - Intergenic
1155551667 18:26972021-26972043 AGGTGTGGCAGGGGTGTGGAGGG + Intronic
1156384500 18:36593409-36593431 AGGTATGACAGCAGAGGAGAGGG + Intronic
1156778309 18:40820736-40820758 AGAGGAGGAAGAGGAGGAGAAGG - Intergenic
1156791724 18:40983923-40983945 GGAGGTGGAAGAGGAGGAGAAGG - Intergenic
1156961632 18:43039020-43039042 AGATGTGGCAGTGAAGGAAAAGG - Intronic
1157276063 18:46311874-46311896 GGATGTGGCGGAGGAGGAGGAGG + Intergenic
1157344635 18:46814712-46814734 AGGCAGAGCAGAGGAGGAGAAGG - Intronic
1158258790 18:55586107-55586129 AGGTCTAGAAGAGGAGGAGGAGG + Intronic
1158384644 18:56975435-56975457 AAGTGTGATAGAGGAGGAGGTGG + Intronic
1158446274 18:57524683-57524705 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1158462320 18:57657099-57657121 AGGAGTGGGAGACGAGGGGAGGG - Intronic
1158602273 18:58864682-58864704 AGGTCTTCCTGAGGAGGAGAAGG - Intronic
1158938169 18:62384265-62384287 AGGAGAGGAAGAGGAGGAGGAGG - Intronic
1158938186 18:62384327-62384349 AGGAGGGGAAGAGGAGGAGGAGG - Intronic
1160417168 18:78719549-78719571 TTCTGTGGAAGAGGAGGAGAAGG - Intergenic
1160715872 19:576283-576305 AGGTCTGGAGGATGAGGAGAGGG + Intronic
1160835280 19:1122050-1122072 AGGAGTGGGAGAGGAGGGGTGGG - Intronic
1161057544 19:2198275-2198297 AGGTGTGGAGAGGGAGGAGACGG + Intronic
1161080682 19:2308499-2308521 ACGGGGGGCAGAGGAGGCGATGG - Intronic
1161323067 19:3650108-3650130 ATGGATGGCAGAGGAGGAGCCGG - Intronic
1161328231 19:3673501-3673523 AGGTGTGTCAGAGTAGCACAGGG + Intronic
1161370585 19:3908779-3908801 AGGGGAGGAAGAGGAGGAGAAGG - Intronic
1161415729 19:4145440-4145462 AGGAGGGGAAGAGGGGGAGAAGG + Intergenic
1161591617 19:5131587-5131609 GGGTGGGGCAGGGGAGGAGGGGG + Intronic
1161956602 19:7499409-7499431 AAGTGTGGCAGAAACGGAGATGG + Intronic
1162029745 19:7912260-7912282 GGGTGGGGCTTAGGAGGAGACGG - Intronic
1162287079 19:9746868-9746890 AGGGGTGGTAGAGTAGCAGATGG - Intergenic
1162327935 19:10009659-10009681 ATTTGGGGCAGAGGAGGAAAAGG + Intronic
1162722931 19:12673142-12673164 AGGGGTGGGAGAGGAGGGAAGGG - Intronic
1162857491 19:13480226-13480248 AGGGGTGGCAGAGGTGGAGGTGG - Intronic
1162999322 19:14356206-14356228 AGGTGTGGCTGGGGAGGTGGTGG + Intergenic
1163029890 19:14537200-14537222 AGGTGGGGCTCAGGAGGAGGAGG + Intronic
1163064809 19:14785146-14785168 AGGTGTGGCTGGGGAGGTGGTGG - Intergenic
1163083005 19:14956905-14956927 AGATGTGGAAGAGCAGGAGGAGG - Intronic
1163163904 19:15482285-15482307 AGGGGTGGCAGAGGTGGAAGAGG - Intronic
1163164019 19:15483058-15483080 AGGGGTGGCAGAGGTGGAAGAGG - Intronic
1163634304 19:18431285-18431307 GGGTTTGGCTGAGGAGGGGAGGG - Intronic
1163641921 19:18466870-18466892 TGGTGTCACAGAGGAGGAGACGG - Intronic
1163692645 19:18745804-18745826 GGGTCTGGGGGAGGAGGAGATGG - Exonic
1164234889 19:23323335-23323357 AGGAGGGGGAGAGGAGGAGGAGG - Intronic
1164249787 19:23466648-23466670 AGCAGTGGAAGAGGAGGAGGAGG - Intergenic
1164249893 19:23467308-23467330 AGGAGTGAAGGAGGAGGAGAAGG - Intergenic
1164250173 19:23468944-23468966 AGGAGTAGAGGAGGAGGAGAAGG - Intergenic
1164292464 19:23880459-23880481 AGAAGGGGGAGAGGAGGAGAAGG + Intergenic
1164541088 19:29122077-29122099 AGGACTTGCAGAGCAGGAGAGGG - Intergenic
1165100072 19:33434050-33434072 ACTGGTGACAGAGGAGGAGAGGG - Intronic
1165611855 19:37161598-37161620 AGAGGCGGAAGAGGAGGAGAAGG - Intronic
1165800102 19:38544049-38544071 GGGAGGGGCAGAGGAGGAGGCGG - Intronic
1165811187 19:38612795-38612817 AGGAGGGGCAGAGAAGGAGAAGG + Intronic
1165830567 19:38728437-38728459 AGGTGGGGGGGAGGAGGAGGAGG - Intronic
1165925642 19:39324518-39324540 AGAAGAGGAAGAGGAGGAGAAGG + Intergenic
1166110759 19:40621643-40621665 GGCTGTGGAAGGGGAGGAGAAGG + Intronic
1166755617 19:45189147-45189169 GGAGGTGGCAGAGGAGGGGATGG - Intronic
1166866066 19:45838192-45838214 TCGTGTGGCAGAGCAGGAGCAGG - Intronic
1166882840 19:45939789-45939811 AGTTGGGGGGGAGGAGGAGAGGG + Exonic
1167112026 19:47468216-47468238 TGGTGAGGCTGAGGAGCAGAGGG - Intronic
1167190986 19:47989550-47989572 AAGTGGGACAGAGGAGGTGAAGG - Intronic
1167240022 19:48338207-48338229 GGGAGCTGCAGAGGAGGAGACGG - Intronic
1167373964 19:49101547-49101569 AGGTGTGGCAGGGTGGGGGAGGG - Intronic
1167466560 19:49653443-49653465 AGGTGGGGCGGAGGAGGAGGAGG + Exonic
1167503266 19:49858859-49858881 TGATGTGGCAGAGGAGGAGCAGG - Intronic
1167674554 19:50876399-50876421 AGATGGGGCAGGGGAGGATAAGG - Intronic
1168120221 19:54247774-54247796 GGGATTGGCAGAGTAGGAGATGG - Intronic
1168238227 19:55076511-55076533 GGGTGTGGGTGAGGAGGCGAGGG - Intronic
1168252156 19:55147284-55147306 GGGTGTGAGAGAGGAGGAGCTGG + Intronic
1168252165 19:55147320-55147342 GGGTGTGAGAGAGGAGGAGCTGG + Intronic
1168483463 19:56740928-56740950 AGGGAAGGCAGGGGAGGAGAGGG - Intergenic
1168483483 19:56740978-56741000 AGGGAAGGCAGGGGAGGAGAGGG - Intergenic
1168483502 19:56741028-56741050 AGGGAAGGCAGGGGAGGAGAGGG - Intergenic
1168597102 19:57686254-57686276 AGGTATAGCACAGGAGGAGAAGG - Intronic
1168695823 19:58404171-58404193 GGGTGGAGCAGAGGAGTAGAGGG - Intronic
925075832 2:1014892-1014914 AGGGGTGGGAGTTGAGGAGATGG + Intronic
925274146 2:2637013-2637035 AGCTGTGGCATCGGAGGAGCAGG - Intergenic
925380099 2:3418882-3418904 AGGTGAGGCAGAGGAGGGTCGGG - Intronic
925518349 2:4710309-4710331 AGCTGTGTCCCAGGAGGAGAAGG + Intergenic
925615120 2:5737881-5737903 GGGCGTGGCCGAGGAGGAAATGG + Intergenic
925627318 2:5854091-5854113 AGGTCGGACAGAGTAGGAGAGGG - Intergenic
925633207 2:5916094-5916116 GGGTGTGGCTGAGCAGGAGAAGG - Intergenic
925843419 2:8013242-8013264 AGGTGAGACATAGGAGGACAAGG + Intergenic
925969403 2:9096218-9096240 AAGTGAGGGAGGGGAGGAGAAGG + Intergenic
925985729 2:9213324-9213346 AGGAGTGGGCGAGGAAGAGAAGG + Intronic
926010056 2:9400324-9400346 GGGAGGGGGAGAGGAGGAGAAGG - Intronic
926229445 2:10991718-10991740 AGAGGTGGAAGAGGAGGAGGAGG + Intergenic
926434129 2:12821442-12821464 AGCTGTGGCAGTGGAGTAGGTGG - Intergenic
926524541 2:13961093-13961115 AGGAGAGGCAAAGAAGGAGAAGG + Intergenic
926785861 2:16517922-16517944 AGGTGGGGCAGGGGAAAAGAAGG - Intergenic
926924558 2:17974005-17974027 AACTGGGGCAGAGGAGTAGAAGG + Intronic
927038411 2:19204185-19204207 GGGTGAGGGAGAGGAGGAGGGGG - Intergenic
927119328 2:19940627-19940649 ATGTGAGGCAGAGGGGAAGAGGG - Intronic
927367666 2:22317996-22318018 AGGTGAGGCAGAGCAGGAAACGG + Intergenic
927848784 2:26485981-26486003 ATGTGTGTCGGATGAGGAGATGG + Intronic
928010162 2:27599887-27599909 GGGTGTTGAAGAGGAGGAGAGGG + Intronic
928105852 2:28470139-28470161 AGGAGAGGAAGAGGAGGAGGAGG + Intronic
928737386 2:34307992-34308014 AGATGGGGAAAAGGAGGAGAAGG + Intergenic
928838737 2:35579693-35579715 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
929442400 2:41974214-41974236 AGGGCAGGGAGAGGAGGAGAGGG + Intergenic
929535833 2:42783660-42783682 AGGTGTGGGAGAGCAGGAAAAGG + Intronic
929556873 2:42931085-42931107 TGGTGGGGCAGAGCAGGAGGAGG - Intergenic
929557816 2:42936592-42936614 GGGAGAGGCAGAGGAGGACAGGG - Intergenic
929778292 2:44942036-44942058 AGGGGAGGAAGAGGAGGAGAGGG - Exonic
929778890 2:44944786-44944808 AGGAGTGGGGGAGGAGGGGAAGG - Exonic
929919392 2:46161651-46161673 GGGTGTGGCAGAGGAAGCCAGGG + Intronic
930084105 2:47480324-47480346 AGGTAAGGGAGGGGAGGAGAGGG - Intronic
930364665 2:50424250-50424272 AAGTGAGGAAGAGGAGGACAGGG + Intronic
930735729 2:54776716-54776738 TGGGGTGGCACAGGAGGGGAGGG - Intronic
931162602 2:59709800-59709822 AGGGGTGGCAGAGGCGGAAGAGG - Intergenic
931236181 2:60414147-60414169 AGGATTGGCAAAGGAGGAGGGGG - Intergenic
931320403 2:61170336-61170358 AGGGGTGGCAGAGGCGGAAGAGG - Intergenic
931356117 2:61538561-61538583 AGGGGTGGAGGAGGAGGAGGTGG + Intronic
931433217 2:62226264-62226286 AGGTGTGGACAAGTAGGAGATGG - Intergenic
931896777 2:66740449-66740471 AGGAGTGGCAGAGGTGGAAGAGG + Intergenic
932167950 2:69525421-69525443 AGCTGTGCTATAGGAGGAGAAGG - Intronic
932214283 2:69956510-69956532 AGGGGAGGAGGAGGAGGAGAAGG + Intergenic
932398743 2:71465573-71465595 AGGTGTGGAGGAGGCGGAGTTGG + Intronic
933422913 2:82074869-82074891 AGAGGGGGCAGGGGAGGAGATGG - Intergenic
933463622 2:82621781-82621803 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
933810788 2:86031602-86031624 GAGTGAGGAAGAGGAGGAGAGGG - Exonic
933835618 2:86243121-86243143 AGGTGAGGGACAGGATGAGATGG + Intronic
934130751 2:88946485-88946507 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934132768 2:88965448-88965470 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934140775 2:89045190-89045212 AGGTGCTGCAGCCGAGGAGACGG - Intergenic
934146418 2:89099046-89099068 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934222849 2:90101529-90101551 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
934228459 2:90155352-90155374 AGGTGCTGCAGCCGAGGAGACGG + Intergenic
934544281 2:95201706-95201728 AGATTTGGCAGTGGAGGAGGGGG + Intergenic
934657328 2:96123065-96123087 AGCTGGGGCAGAGGAGGAAGGGG + Intergenic
934715021 2:96538106-96538128 TGGTGTGGCAGAGGTAGAAAGGG + Intronic
934843213 2:97644797-97644819 AGGGGTTGCAGTGGAGGTGAGGG + Intergenic
934852921 2:97712788-97712810 AGGAGAGGAAGAGGAGGAGGAGG + Intergenic
934912953 2:98275947-98275969 AGGTGAGCCAGTGCAGGAGAAGG + Intronic
934991372 2:98924305-98924327 AGGTGGGGCAGAGAGGGAGGTGG - Intronic
935115943 2:100136312-100136334 AGATGTGGGAGAGGTGGAGAAGG + Intronic
935323789 2:101915609-101915631 AGGGGTGGCAGATGTGGAGGAGG - Intergenic
935627295 2:105181623-105181645 ATGAATGGCAGAGGTGGAGATGG + Intergenic
935743320 2:106170044-106170066 AGGTGCAGCTGGGGAGGAGAGGG - Intronic
935755109 2:106270678-106270700 AGCTGTGGCAGTGGAGGTGCGGG - Intergenic
936038538 2:109130564-109130586 CGGTGTGGCTAAGGAGGGGAGGG + Intronic
936467701 2:112767876-112767898 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
936605191 2:113944940-113944962 AGTTGTGGGAAAGGAGGAAAAGG + Intronic
936755994 2:115713257-115713279 AGTTATGGCAAAGAAGGAGAAGG + Intronic
936756839 2:115724330-115724352 AGTTGTGGCAGAAGAGAAGGTGG + Intronic
937051297 2:118893288-118893310 AGTTGTGGCAGAGGTGGGCATGG - Intergenic
937298370 2:120823421-120823443 AGGTGTGGAGGAGGCAGAGAGGG + Intronic
937438572 2:121898376-121898398 AGGGGAGGAAGAGGGGGAGATGG + Intergenic
937586378 2:123556578-123556600 AGGTTTGATAAAGGAGGAGAAGG - Intergenic
938131026 2:128715662-128715684 AGGTGGAGGAGAGGAGGAGCTGG + Intergenic
938250588 2:129812890-129812912 AGGTGTGGGAGGGGAGGAAGAGG - Intergenic
938548143 2:132353334-132353356 AGCTCTGGCAGAGGAGGACCCGG + Intergenic
938690370 2:133782936-133782958 AGATTTGACAGAGGAGGAGGAGG - Intergenic
938742553 2:134246454-134246476 AGGAGAAGCAGAGGAGGAGAAGG - Intronic
938746981 2:134288835-134288857 AGGTGTGGGAGTAGGGGAGAGGG - Intronic
938782084 2:134593629-134593651 AGTTGGGGCAGAGGAGAGGAGGG + Intronic
938986657 2:136583132-136583154 TGGTTTGGCAGAGGAGAACAAGG + Intergenic
939283151 2:140091050-140091072 AGGGCTGGCAGAGGTGAAGAAGG - Intergenic
939513955 2:143143115-143143137 GTGAGAGGCAGAGGAGGAGATGG - Intronic
939680788 2:145129523-145129545 AGAGGTGGCAGAGGTGGAGGAGG - Intergenic
939723164 2:145680392-145680414 AGGTGTCCCAGTGGAGAAGAGGG - Intergenic
940432925 2:153615001-153615023 AGGTGTTGCGGAGGTGGTGATGG - Intergenic
940520862 2:154746028-154746050 AGGAGAGGAAGAGGAGGAGTTGG - Intronic
940543550 2:155053644-155053666 AGATGTGCCAGATGATGAGATGG - Intergenic
940666422 2:156616056-156616078 GGGTGTGGCAGTGGAGAACAGGG + Intergenic
940669348 2:156648834-156648856 AGGAGTGGGAGGGGAGGGGAGGG - Intergenic
941144336 2:161824890-161824912 AGGAGTGGCAGAGGCAGAAAAGG - Intronic
941309473 2:163911527-163911549 AGGAGAGGAGGAGGAGGAGAAGG - Intergenic
941575009 2:167219117-167219139 ATGTGTGGCAGGGGATGAGGCGG + Intronic
942602800 2:177658453-177658475 AGGAGAGGCAGAGGAGGGAAGGG - Intronic
943197256 2:184769682-184769704 TGGTGTGGCAGAGGAGAGCAAGG + Intronic
944119709 2:196227729-196227751 AGGTGGGGATGAGGAGGGGAAGG - Intronic
944663955 2:201943898-201943920 AGGGGTGGCAGAGATGGAGGAGG + Intergenic
944675908 2:202034114-202034136 GGGTGTGGAGGAGGAGGCGAAGG + Intergenic
944859780 2:203804295-203804317 TGGGGTGGCAGAGGAGGCTAGGG + Intergenic
945366988 2:208966328-208966350 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
945564572 2:211381188-211381210 AAGTATGGTAGAGCAGGAGAAGG - Exonic
945988152 2:216371404-216371426 AGAGGAGGAAGAGGAGGAGAAGG - Exonic
946065703 2:216985614-216985636 TGGTGTGGCAGAGGGGAAGGTGG + Intergenic
946126403 2:217566833-217566855 ATCTGTGGAAGACGAGGAGATGG + Intronic
946201660 2:218074042-218074064 GGGAGCTGCAGAGGAGGAGAGGG + Intronic
946354918 2:219178460-219178482 CAGTGAGGCAGAGGAGGAGGCGG + Exonic
946399378 2:219460676-219460698 TGGTGTGGAGGGGGAGGAGAGGG - Intronic
946523411 2:220491708-220491730 AGGAGAGGAAGAGGAGGAGGGGG - Intergenic
946713784 2:222532603-222532625 AGGTGTGGGAAGGGAGGAGCTGG - Intronic
947009189 2:225547089-225547111 TTGTGTGGGAGGGGAGGAGAGGG - Intronic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947524617 2:230870580-230870602 AGGTGTGGCAGAGAAGGGCAGGG - Intronic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
947817626 2:233048709-233048731 AGGAGTGGGTGGGGAGGAGAGGG + Intergenic
947869769 2:233428123-233428145 AGGGGAGCCAGAGGAGGAGGAGG + Intronic
947885832 2:233570270-233570292 AGGAGTGGCAGAGGGGGAATTGG - Intergenic
948005513 2:234604767-234604789 GGGGTTGGCAGAGGAGGAGGAGG - Intergenic
948058360 2:235026209-235026231 AGGTCAGGAAGAGGAGGGGAGGG - Intronic
948073911 2:235150118-235150140 AGATGTGGCAGAAAAAGAGAGGG + Intergenic
948454314 2:238097646-238097668 AGGAGGGGCAGGGGAGGAAAGGG + Intronic
948562641 2:238864648-238864670 AGGTGCGGGAGAAGAGGAGGTGG + Intronic
948828406 2:240585664-240585686 CGGTCAGGCAGGGGAGGAGAAGG - Intergenic
948893006 2:240916231-240916253 AGGGATGGGAGAGGAGGGGAAGG - Intergenic
948894593 2:240922309-240922331 ACGGCTGGCAGAGGAGGGGAGGG - Intronic
1168768806 20:400641-400663 GGCTGTGGCAGGGGAAGAGAGGG - Intergenic
1168806015 20:672771-672793 AGGGGGGGAAGATGAGGAGAGGG - Intronic
1169264208 20:4157811-4157833 AGGTGTGGCAGAGGCGAGGCAGG - Intronic
1169318709 20:4613475-4613497 GGGTGGGGCAGAGGGAGAGAAGG + Intergenic
1169784226 20:9341602-9341624 AGGGGTGGCAGAGGTGGAGGAGG + Intronic
1169997307 20:11572526-11572548 GGGTGTGGCGGGGGAGGGGAGGG + Intergenic
1170354809 20:15480524-15480546 AAGGGGGGCAGAGGAGGAGTAGG - Intronic
1170429366 20:16262505-16262527 AGGGGTGGGAGAGGAGGTGGAGG - Intergenic
1170441906 20:16387653-16387675 ATGTCTGGAAGGGGAGGAGAAGG + Intronic
1171070486 20:22063305-22063327 AGGTGAGGAGGAGGAGGAGAAGG - Intergenic
1171090927 20:22285293-22285315 GAGTCTGGAAGAGGAGGAGAAGG - Intergenic
1171288194 20:23960810-23960832 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1171357306 20:24557953-24557975 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1171394198 20:24820598-24820620 AGATGTTGGAAAGGAGGAGAAGG - Intergenic
1171767443 20:29297846-29297868 CGGTGTGGCAGAGGCGATGATGG + Intergenic
1171810507 20:29742250-29742272 CGGTGTGGCAGAGGCGAGGATGG + Intergenic
1171877014 20:30586106-30586128 AGCTCTGGCAGAGGAGGACCCGG + Intergenic
1172077570 20:32310950-32310972 GGGTGGGGAAGAGGAGGAGGAGG + Exonic
1172367714 20:34362918-34362940 AGATCTGGCATAGGAGGATAGGG - Intergenic
1172437965 20:34943479-34943501 TGCTGTGGAGGAGGAGGAGAAGG - Intronic
1172474330 20:35226322-35226344 GGGAGTGGCATTGGAGGAGAGGG - Intergenic
1172816914 20:37694357-37694379 GGGTGAGGAAGAGGAGGTGAAGG - Intronic
1173134199 20:40424898-40424920 TGATGTTGAAGAGGAGGAGAAGG + Intergenic
1173289901 20:41705484-41705506 AGAGGTGGAAGAGGTGGAGAAGG - Intergenic
1173430409 20:42982745-42982767 GGGTGTGGGAGAGGAGCAGAGGG - Intronic
1173497528 20:43530217-43530239 AGGTGAGGCAGATGGGGAGTGGG + Intronic
1173752372 20:45487466-45487488 GGGGGTGGCAGTGGAGGCGAAGG - Intergenic
1173787378 20:45804260-45804282 AGGTAAGGAAGAGGAGGAGGAGG - Intronic
1173843793 20:46175510-46175532 TGGTGTGGCAGAGGAGGGTGAGG - Intronic
1173906727 20:46634931-46634953 AGGTGCGGGAGAGGATGACAGGG - Intronic
1173920995 20:46744483-46744505 ATCTGTGGCAGAGGAGGAGGAGG + Intergenic
1174143097 20:48430720-48430742 AGGGGTGGGAGAGGAGGATCAGG + Intergenic
1174392611 20:50227077-50227099 TGGGGTGGCAGAGGCGGGGATGG + Intergenic
1174451502 20:50623565-50623587 GGATGTGTGAGAGGAGGAGAAGG + Intronic
1174455015 20:50642706-50642728 ATGTGGGGCAGAGGGTGAGAGGG - Intronic
1174527522 20:51185432-51185454 AACTCTGGGAGAGGAGGAGAGGG - Intergenic
1174682524 20:52422625-52422647 AGCTGTGGGGGAGGTGGAGATGG - Intergenic
1174702440 20:52622600-52622622 AAGTGTGGGAGAAAAGGAGATGG - Intergenic
1175039730 20:56037365-56037387 ATGTGTGGGGGAGTAGGAGAGGG - Intergenic
1175364512 20:58443098-58443120 AGTTGTGGCAGTGGAGGTGAAGG + Intronic
1175380408 20:58558796-58558818 AGGGTGGGGAGAGGAGGAGAGGG + Intergenic
1175569923 20:60010714-60010736 AGGTTGGGGAGAGGAGGAGATGG + Intronic
1175747832 20:61473007-61473029 TGGTGGGGCAGGGGAGGGGAGGG + Intronic
1175891599 20:62318280-62318302 AGGGGAGGAAGAGGAGGAGGGGG + Intronic
1176037879 20:63049199-63049221 AGGGGAGGAAGAGGAGGAGGAGG - Intergenic
1176037890 20:63049234-63049256 AGGAGAGGAAGAGGAGGAGGAGG - Intergenic
1176037901 20:63049275-63049297 AGGGGAGGAAGAGGAGGAGGAGG - Intergenic
1176100671 20:63363062-63363084 AGGAGAGGAGGAGGAGGAGAGGG - Intronic
1176238973 20:64067223-64067245 AGGTGTGGCCTAGGAGGCCAGGG + Intronic
1176257009 20:64158130-64158152 AGGTGGGGCAGGTGAGGACAGGG - Intronic
1176257045 20:64158239-64158261 AGGTGGGGCAGGTGAGGACAGGG - Intronic
1176604768 21:8819985-8820007 AGCTCTGACAGAGGAGGAGCCGG + Intergenic
1177114898 21:17073442-17073464 AGAGGAGGCAGAGGAGGAGGAGG + Intergenic
1177548159 21:22585904-22585926 AGGAGTTGCAGCTGAGGAGATGG - Intergenic
1177628061 21:23690349-23690371 AGGTGTAGCAGTGGAGCAAAAGG - Intergenic
1177758271 21:25373606-25373628 AGGGGTGGGAGAGGGGGAGGAGG - Intergenic
1178249108 21:30985149-30985171 AGCTGTGGCAGCTGAGGACAGGG - Intergenic
1178400206 21:32278971-32278993 AGGTGTAGCAGAGGATGCGCTGG - Exonic
1178547857 21:33508466-33508488 AAGTGTGGGAGAAGAGGTGAGGG - Intronic
1178683037 21:34689195-34689217 GGGTGGAGCAGAGAAGGAGATGG + Intronic
1178771992 21:35513878-35513900 AGATGTGGAAGAGGTAGAGATGG - Intronic
1178790064 21:35691608-35691630 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1179190743 21:39119760-39119782 AGGTGAGGCAGAGAACAAGAGGG + Intergenic
1179345893 21:40556976-40556998 AGAGGTGGGAGAGGTGGAGAAGG + Intronic
1180040792 21:45278498-45278520 AGGCGTGCCTGAGGAGGGGAGGG + Intronic
1180127355 21:45801405-45801427 AGGAGCTGCAGAGGAGCAGATGG + Intronic
1180186829 21:46144468-46144490 AGGGGAGGGAGAGGGGGAGAGGG - Intronic
1180347058 22:11711590-11711612 AGCTCTGACAGAGGAGGAGCCGG + Intergenic
1180354806 22:11829680-11829702 AGCTCTGACAGAGGAGGAGCCGG + Intergenic
1180383445 22:12162651-12162673 AGTTCTGACAGAGGAGGAGCCGG - Intergenic
1180687505 22:17681008-17681030 AGGTGCGACAGAGTAGGAAATGG - Intronic
1180730815 22:17980794-17980816 GGCTGAGGCAGAGGAGCAGACGG - Intronic
1180785053 22:18542502-18542524 AGGTGAGGAAGAGGAGGAGATGG - Intergenic
1180835531 22:18927710-18927732 GAGTGTGTCAGAGCAGGAGAGGG - Intronic
1181128636 22:20716535-20716557 AGGTGAGGAAGAGGAGGAGATGG - Intronic
1181241956 22:21481856-21481878 AGGTGAGGAAGAGGAGGAGATGG - Intergenic
1181711855 22:24696168-24696190 AGGGGTGGGGGAGGAGGAGGAGG - Intergenic
1181841764 22:25669330-25669352 AGGTGAGGCAGAATTGGAGAGGG + Intronic
1182281076 22:29217962-29217984 GGGTGGGCCAAAGGAGGAGAGGG + Intronic
1182585907 22:31344295-31344317 ACGTGTGGCAGGGGAGGAAGAGG + Intronic
1182623871 22:31632067-31632089 AGGTTTGGAACAGGAGGAGAGGG + Intronic
1182657738 22:31903537-31903559 AGGTGTGGAAGATGGGGGGAGGG - Intronic
1182719433 22:32385550-32385572 ACAGGTGGCATAGGAGGAGATGG - Intergenic
1182774211 22:32818976-32818998 AACTGTGTCAGAGGAGGAGGAGG - Intronic
1183048939 22:35245216-35245238 AGGTGGAGCAGAGGAGGCGGAGG - Intergenic
1183247631 22:36706162-36706184 AGGAGAGGAGGAGGAGGAGAAGG - Intergenic
1183309226 22:37100435-37100457 AGCTGTGGCAGAGGAGAGGGTGG + Intronic
1183585416 22:38750515-38750537 AGGGGTGGCTGGTGAGGAGAGGG - Intronic
1184097154 22:42322529-42322551 AGGTTGGGCAGAGGAGAGGAAGG + Intronic
1184890973 22:47379051-47379073 GGAGGAGGCAGAGGAGGAGAAGG + Intergenic
1185044700 22:48523135-48523157 ACGAGCGGCAGGGGAGGAGATGG - Intronic
1185285201 22:49996941-49996963 AGGTCCTGCAGTGGAGGAGATGG + Intronic
1203285619 22_KI270734v1_random:153009-153031 GAGTGTGTCAGAGCAGGAGAGGG - Intergenic
949330590 3:2917301-2917323 AGACGAGGCAGAGGGGGAGATGG + Intronic
949439116 3:4061540-4061562 AGGTGCTGCAGCTGAGGAGATGG - Intronic
949475514 3:4441464-4441486 ATGTGGGGCAGGGGAGGGGATGG - Intronic
949551561 3:5116207-5116229 AGGCGAGGGAGAGGAGGAGGGGG - Intergenic
950031543 3:9857039-9857061 AGGAATAGCAGAGGAGGAGCTGG - Intergenic
950136534 3:10585013-10585035 GGGTGTGGCAGGGGAGGAGGAGG - Intronic
950590239 3:13931788-13931810 AGGTGTGGCAGGGATGGAGATGG - Intergenic
950708139 3:14796461-14796483 AGTTGAGGGAGAGGAGGAGGTGG - Intergenic
950710317 3:14809374-14809396 AGGTGTGGCAGGGATGGAGATGG - Intergenic
951157894 3:19376957-19376979 AGGTAAGGCAGAGAATGAGATGG + Intronic
951168722 3:19513023-19513045 AGATGAGGAAGAGGAGGAGGAGG + Exonic
951364750 3:21767680-21767702 GGGGGTGGGAGAGGAAGAGAGGG + Intronic
951657501 3:25026155-25026177 AGTTGTGGCATATGAGGAAAGGG + Intergenic
951950007 3:28189612-28189634 GGCTGAGGCAGAGGAGGAGCAGG - Intergenic
951972452 3:28462344-28462366 AGGTGTGGCAAAGAAGGTGTTGG + Intronic
952718929 3:36512221-36512243 ATCAGTGGGAGAGGAGGAGACGG + Intronic
952829687 3:37554344-37554366 TGGTGTGTCTGAGGAGGAGCAGG + Intronic
952924020 3:38308229-38308251 GGTGGTGGCAGAGGAGGAGGAGG + Intronic
953412839 3:42699858-42699880 AGGTGGGGCAGGGGATGTGAAGG - Intronic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
953631601 3:44622700-44622722 AGGTAGGGCAGGGGAGGAGAAGG + Intronic
953689536 3:45106379-45106401 TGGTGGGGCAGACAAGGAGAAGG - Intronic
953750439 3:45604581-45604603 AGGTGAGGCACAGGAGGGGTGGG - Intronic
953804306 3:46054675-46054697 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
954130103 3:48556471-48556493 AGGTGTGGCAGAGCAGGGGGCGG - Intronic
954368358 3:50157608-50157630 AGGTGGGGGAAAGAAGGAGAGGG - Intronic
954411749 3:50374082-50374104 AGGGGAGGGGGAGGAGGAGAGGG + Intronic
954503015 3:51038819-51038841 ATGTGTGGGAGAACAGGAGATGG - Intronic
954577634 3:51685469-51685491 ACGTGTGCTAGAGAAGGAGAGGG + Intronic
954752397 3:52821076-52821098 CAGTGTGGCAGAGCAGGAGGCGG - Exonic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
955051308 3:55413920-55413942 AGATGTGGGAGAAGAGGTGATGG + Intergenic
955058135 3:55474232-55474254 AGGAGTGGCAGAGGAGAGGACGG + Intronic
955158204 3:56438419-56438441 AGGTGCTGCAGCTGAGGAGATGG - Intronic
956098971 3:65747720-65747742 AACTGCGGGAGAGGAGGAGAAGG + Intronic
956409988 3:68969159-68969181 AGGAGTGGCAGTGTGGGAGACGG - Intergenic
957348112 3:78987618-78987640 AGGTGTAGGGGAGGTGGAGATGG + Intronic
957527212 3:81392531-81392553 ACAGGTAGCAGAGGAGGAGATGG + Intergenic
957914630 3:86672333-86672355 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
958019787 3:87981090-87981112 AGCTGTGGCAGGTGAGGTGAAGG - Intergenic
958060006 3:88467297-88467319 AGGAGAGGAAGAGGATGAGATGG - Intergenic
958150177 3:89682791-89682813 GTGTGCAGCAGAGGAGGAGAGGG - Intergenic
958709901 3:97705268-97705290 AGGTGTGAGAGAGGAGGGGATGG - Intronic
958884897 3:99714834-99714856 AGGTGTGCCATAGAGGGAGAAGG + Intronic
959084100 3:101833345-101833367 GGGTGTGGAAGGGGAGGAGAAGG - Intronic
959565253 3:107826625-107826647 AGGAATGTCAGAGGAGGAAAAGG - Intergenic
959817446 3:110691599-110691621 AGATGAGGCAGAGGTGGAGGGGG - Intergenic
960975950 3:123174189-123174211 AGGTGGAGCAGTGGAGCAGAGGG + Intronic
961058662 3:123810298-123810320 AGCAGGGGCAGGGGAGGAGAGGG - Intronic
961094734 3:124144598-124144620 GGATGAGGAAGAGGAGGAGAAGG - Intronic
961410363 3:126716083-126716105 AGGTCTGGCAAAGCAGGAGGAGG - Intronic
961554374 3:127688223-127688245 AAGTGTGCTGGAGGAGGAGAAGG + Intergenic
961563386 3:127746715-127746737 GGGAGTGGCAGAGGACAAGAAGG - Intronic
961714146 3:128847375-128847397 AGGAATGGGAGAGGAGGAGCTGG + Intergenic
962007013 3:131359875-131359897 AGGTGAGGCAGAAGCAGAGAGGG + Intergenic
962009363 3:131379427-131379449 GGGTGGGGCAGAGGCAGAGAAGG + Intergenic
962418652 3:135207628-135207650 AGGGCTTGCAGAGGAAGAGATGG + Intronic
962498398 3:135965659-135965681 GGGTGGGGCCGAGGAGGAGGAGG + Exonic
963038831 3:141053893-141053915 TGGTGAGGAAGAGGTGGAGAAGG - Intronic
963621588 3:147614198-147614220 ATGTGTGGCAGAAAAGAAGAGGG - Intergenic
964376372 3:156052221-156052243 TGGGGTGGCAGGGGAGGAGGTGG - Intronic
964832812 3:160904515-160904537 AAGTGTGGAAGAGGAACAGATGG + Intronic
964847233 3:161057258-161057280 AGGTGAGGCGGAGGAGGGAAGGG - Intronic
965015996 3:163157121-163157143 AGGTGTTTCAGATGAGAAGATGG - Intergenic
965451623 3:168845640-168845662 AGATGAGGAGGAGGAGGAGAAGG - Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966031386 3:175352288-175352310 AGGTGAGGCTGAGGAGAAGAAGG + Intronic
966239499 3:177740572-177740594 AGGTGTGAGAGTGGGGGAGATGG + Intergenic
966270884 3:178104265-178104287 AAGTCTGTAAGAGGAGGAGATGG - Intergenic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
966838792 3:184071030-184071052 AGCTGGGGGAAAGGAGGAGAGGG + Intergenic
967918658 3:194598259-194598281 AGGAGTGTCAGAACAGGAGACGG - Intronic
967945936 3:194804230-194804252 GGATGAGGAAGAGGAGGAGAAGG - Intergenic
967999191 3:195191246-195191268 AGGGGTGGCAGAGGTGGAGGAGG - Intronic
968509903 4:991015-991037 AGGGTTGGCAGAGGAGGTGCTGG - Intronic
968684870 4:1951193-1951215 ATGTGTGCCAGGTGAGGAGAAGG + Exonic
968889326 4:3359260-3359282 GGGTGAGGGAGAGGAGGAGGTGG - Intronic
969315620 4:6379997-6380019 AGGAGAGGCAGGGGAGGGGAGGG - Intronic
969370323 4:6727648-6727670 AGGAGGGGGAGGGGAGGAGAAGG - Intergenic
969451650 4:7277218-7277240 TGGAGTGGGAGAGGAGGTGAAGG + Intronic
969599481 4:8167425-8167447 TGGCCAGGCAGAGGAGGAGAGGG - Intergenic
969979000 4:11135040-11135062 AGGAGGGGGAGAGGAGGGGAGGG - Intergenic
970194624 4:13542403-13542425 AGGCGTCGCGGAGGAGGAGGAGG - Exonic
970195567 4:13547561-13547583 AGGTGTGGAGGAGGAGGGGAGGG - Intergenic
970721663 4:18996103-18996125 TCCTGTGGCAGAAGAGGAGAAGG - Intergenic
971174027 4:24263602-24263624 AGGTACGGCAGAAGTGGAGATGG - Intergenic
971352798 4:25867900-25867922 AGTTGTGGTAAAGGAGGAAAAGG + Intronic
971532801 4:27710272-27710294 GTGTGTGGCAGTGGTGGAGATGG + Intergenic
971545284 4:27878776-27878798 GGGTGTGGCAGAGTAAGAGAGGG - Intergenic
972760643 4:42100152-42100174 AGGTAGAGGAGAGGAGGAGATGG - Intergenic
973204634 4:47546510-47546532 AGGTTTGAAAGGGGAGGAGATGG + Intronic
973373355 4:49270952-49270974 AGCTCTGACAGAGGAGGAGCCGG - Intergenic
974280562 4:59786237-59786259 AGATGAGGAAGAGGAGGAGGAGG - Intergenic
974462591 4:62206923-62206945 AGCGGTGGCAGAGGAGGAGAAGG - Intergenic
975653775 4:76620690-76620712 CGGTGAGGCAGAGGCGGAAAGGG + Intronic
976085635 4:81404501-81404523 ATGTTTGGGAGAGGTGGAGAGGG + Intergenic
976633407 4:87263059-87263081 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
976659470 4:87524679-87524701 AGGTGCTGCAGCTGAGGAGATGG - Intronic
976732551 4:88278682-88278704 GAGAGGGGCAGAGGAGGAGAGGG + Intronic
976990575 4:91359832-91359854 TGGTGTGGCAGAGGTGGTGGTGG + Intronic
977525427 4:98140261-98140283 AGGTGTGGGAGATGAGGTCAGGG + Intronic
977537398 4:98270781-98270803 AGGTGTGGCAGAGGTGGAGGAGG - Intronic
977805993 4:101298472-101298494 AAGGGTGGCAGAGAAGGAGTAGG - Intronic
977961203 4:103087453-103087475 ATGGGTAGCTGAGGAGGAGAGGG + Intronic
978134027 4:105235164-105235186 ACCTGTGGAAGAGGAGGAGGGGG - Exonic
978776182 4:112509373-112509395 ATGCGGGGCCGAGGAGGAGAAGG + Intergenic
978835742 4:113147538-113147560 AGGTGTGGTAGAGGTGGAAGTGG + Intronic
978905086 4:113996066-113996088 GAGTGGGGAAGAGGAGGAGAAGG + Intergenic
979416897 4:120452449-120452471 AGGGGTGGAATAGGAGGAGAAGG + Intergenic
979551554 4:121996841-121996863 AGGTGTGGGATGGGAGCAGATGG - Intergenic
979694337 4:123595339-123595361 AGATGAAGAAGAGGAGGAGAAGG - Intergenic
979929858 4:126617145-126617167 TTGTGTGCCAGAGGAGGAGCAGG + Intergenic
980328421 4:131379358-131379380 AGGTGTGGAGGAGGAGGCGCGGG + Intergenic
980714803 4:136615325-136615347 AGGGGTGGTAGAGTAGCAGATGG - Intergenic
980962696 4:139492128-139492150 GGGTGAGGCTGGGGAGGAGAGGG - Intergenic
980969958 4:139558430-139558452 ACGTGTGGGAGTGAAGGAGAGGG + Intronic
981025058 4:140069492-140069514 AGGAGGGGAGGAGGAGGAGAAGG + Intronic
981066152 4:140488541-140488563 AGGAGTAGGAGAGGTGGAGAAGG + Intronic
981238316 4:142443876-142443898 AAGTGGGGCAGAAGAGGAGAAGG + Intronic
981254393 4:142644272-142644294 AGGAGTGGGGGAGGAGGAGAAGG + Intronic
981448590 4:144869409-144869431 AGGAATGACAGAGGTGGAGAAGG + Intergenic
981514026 4:145587766-145587788 GGGAGTGGAGGAGGAGGAGAAGG + Intergenic
981809671 4:148759533-148759555 AGAGGTGGCAGAGGTGGGGAAGG + Intergenic
982220938 4:153124666-153124688 AGATGAGGCTGACGAGGAGAAGG + Intergenic
983279122 4:165658464-165658486 AGGGGTGGCAGAGGAGGAAGAGG + Intergenic
983434038 4:167688772-167688794 AGATGTGGCTGAGAAGGGGAAGG - Intergenic
983933784 4:173481594-173481616 AGGGGTGGCAGAGGCGGAAGAGG - Intergenic
983946041 4:173586348-173586370 AGGTGTGTCTGAGGAGGTGCTGG + Intergenic
984231108 4:177100448-177100470 AGCTGTGCCAGAGTAGGGGATGG - Intergenic
984870005 4:184317376-184317398 AGGTGGAGCAGAGGAGAAGGTGG - Intergenic
985245894 4:187979416-187979438 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
985269262 4:188178969-188178991 AGGTGTGGAGGAAGAGGCGAGGG + Intergenic
985295254 4:188431055-188431077 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
985632303 5:1020441-1020463 AGGTGTGGCTGAGGCTGAGCAGG - Intronic
985641839 5:1067092-1067114 AGGGGTGCCTGAGGAGGAGTGGG - Intronic
986491671 5:8297949-8297971 AGGTGAGGCAGATGGAGAGATGG + Intergenic
986654832 5:10000512-10000534 TACTGTGGCAGAGCAGGAGAGGG + Intergenic
987009911 5:13751856-13751878 GGGTGGGGCAGAAGGGGAGAGGG + Intronic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
987046656 5:14115344-14115366 AGGGCTGCCAAAGGAGGAGATGG + Intergenic
987118114 5:14742445-14742467 AGGTGTGTCAGGGGAAGAGCAGG - Intronic
987295916 5:16551272-16551294 ATGTGTGGAGGAGGAGGGGAAGG - Intronic
988210918 5:28202271-28202293 TGGTGTTGCAGCTGAGGAGATGG + Intergenic
988530450 5:32022891-32022913 CAGCGTGGCAGAGGAGGAGTGGG + Intronic
988566244 5:32321762-32321784 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
989004007 5:36789582-36789604 AGATTTGGCAGAGGTGGGGAGGG + Intergenic
989242630 5:39218309-39218331 AGGTGAGGGGGAGGAGGATAAGG - Intronic
989462367 5:41715260-41715282 AGAGGTGGCAGAGATGGAGAAGG + Intergenic
989478829 5:41904466-41904488 TGGTGAGGGAGCGGAGGAGAGGG + Exonic
989751803 5:44903815-44903837 AGGTGGGGCAGAGTAAGTGATGG - Intergenic
989987096 5:50713776-50713798 AGGCGAGTCAGAGAAGGAGATGG + Intronic
990079753 5:51898907-51898929 AGGAGTGGCAGAGGTGGAAGAGG + Intergenic
990079755 5:51898916-51898938 AGAGGTGGAAGAGGTGGAGAAGG + Intergenic
990379502 5:55208009-55208031 AGGTGGGCAAGAGGAGGAGAAGG + Intergenic
990629761 5:57655307-57655329 AGGTGTCGGGGAGGAGGGGATGG - Intergenic
991216977 5:64166260-64166282 AGGTGTGGCGGAGGAGGCCGGGG + Intronic
991461469 5:66863626-66863648 ACGTGTGGCAGCTGAGGAGGTGG - Intronic
992090641 5:73312935-73312957 AGGAGAAGAAGAGGAGGAGAAGG - Intergenic
992349656 5:75916204-75916226 AGGGGAGGAAGAGGAGGAGGAGG - Intergenic
993033362 5:82729837-82729859 AGGGGTGGCAGAGGTGGAGGAGG - Intergenic
993467394 5:88265801-88265823 AGGTGTGGGAGAGTAGGCCATGG - Intronic
993502173 5:88676377-88676399 AGAGGTGGAAGAGGAGGAGGAGG - Intergenic
993631840 5:90295250-90295272 AGGTGTAAAAGAGGAAGAGAAGG + Intergenic
993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG + Intronic
994036652 5:95209399-95209421 AGGTGTGACAGAAGGAGAGAGGG - Intronic
994433430 5:99697670-99697692 AGGTGTTGCAGCCAAGGAGATGG - Intergenic
994599185 5:101880576-101880598 AGGGATGGCAGATGAGCAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
994952773 5:106486099-106486121 AGGTGGGGCAGAGGGGGAAGAGG - Intergenic
995067089 5:107874707-107874729 AGGGTTGGAAGAGGAGGAGATGG + Intronic
995069159 5:107898345-107898367 AGGGGTGGCAGAGGAGGAAGAGG - Intronic
995414873 5:111898374-111898396 AGGGGTGGAAGAGAAAGAGAAGG + Intronic
995688257 5:114795123-114795145 AGATGTGGAAGAGCAGGAGAAGG + Intergenic
995808168 5:116077644-116077666 GGGTGGGGAAGAGGATGAGAGGG - Intergenic
995933016 5:117473601-117473623 AGATGTGGAACAGCAGGAGATGG - Intergenic
996005394 5:118414948-118414970 AGGTTGGGCAAATGAGGAGATGG + Intergenic
996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG + Intergenic
996423795 5:123290945-123290967 ATCTGTGGAAGAGGTGGAGAAGG - Intergenic
996502318 5:124230598-124230620 AGGTGAGCCAGTGCAGGAGACGG - Intergenic
996779740 5:127172393-127172415 AATGGTGGCAGAGGTGGAGAGGG + Intergenic
997066936 5:130571805-130571827 AGGGGTAGCAAAGGAGGGGAGGG - Intergenic
997083139 5:130764591-130764613 AGGCAGGGGAGAGGAGGAGATGG - Intergenic
997157711 5:131576921-131576943 AGGGGTGGTAGAGTAGCAGATGG - Intronic
997822415 5:137078035-137078057 AGGCATGGCAGAGGAGAGGAGGG + Intronic
998139715 5:139693023-139693045 ATGGGTGGAAGAGCAGGAGAAGG - Intergenic
998194757 5:140058735-140058757 AGGGGTGGCAGAGGTGGAAGAGG - Intergenic
998228243 5:140343150-140343172 GGGTGTGGGGGAGTAGGAGATGG - Intronic
998676132 5:144410006-144410028 AGGTGAGGGTGAGGAGGGGAAGG + Intronic
998821025 5:146058097-146058119 AGGTTTTGCAAAGGTGGAGAGGG - Intronic
999195035 5:149776042-149776064 TGGTATGGCAGAGAAGGAGGTGG - Intronic
999244286 5:150145070-150145092 AGGGGTGGCAGAGGCGGAAGAGG - Intronic
999673351 5:153976265-153976287 AGGAGCAGCAGAGGTGGAGAAGG - Intergenic
999704120 5:154255856-154255878 AGGCAGGGGAGAGGAGGAGAGGG - Intronic
999704350 5:154258178-154258200 AGGTATGGGAGAGGAGGGAAAGG - Intronic
1000116614 5:158159853-158159875 AGGGATGACAGAAGAGGAGATGG - Intergenic
1000126646 5:158251702-158251724 TGGGGTGGCAGGGAAGGAGAGGG - Intergenic
1000138880 5:158381990-158382012 GGGTGTGCCTGTGGAGGAGAGGG - Intergenic
1000360812 5:160445389-160445411 GGGTGTGGGAGGGGAGGATAGGG + Intergenic
1000540849 5:162538079-162538101 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1000922378 5:167153494-167153516 AGGGGTGGAAGAGGGGGAGGAGG + Intergenic
1000944238 5:167400710-167400732 AGGTGAGTCAGTGGAAGAGATGG + Intronic
1001400278 5:171442315-171442337 AGAGGTGGCAATGGAGGAGAAGG - Intronic
1001570515 5:172727589-172727611 AGGTGTGGCAGAGCAGGTGTGGG - Intergenic
1001704360 5:173731047-173731069 ATGTGTGGGAGGGCAGGAGATGG - Intergenic
1002090640 5:176803530-176803552 AGGAGGAGCGGAGGAGGAGAAGG - Intergenic
1003018429 6:2487917-2487939 AGGTGTGGGGGAGTAGGAGGTGG + Intergenic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1003698326 6:8435447-8435469 AGGAGTGGGCGAGGAGGAGGAGG - Exonic
1003998481 6:11568089-11568111 AGGAGTGAGAGAGGAAGAGAGGG + Intronic
1004279439 6:14268507-14268529 AAGTGTTGGAGGGGAGGAGAAGG + Intergenic
1004642755 6:17531609-17531631 AGGTGTAGAAGAGAAGAAGAAGG - Intronic
1004727565 6:18325989-18326011 AGGTTGGGGAGAGGAGGAAATGG - Intergenic
1005035154 6:21549178-21549200 AGGTGCTGCAGAAGAGGAGATGG + Intergenic
1005255383 6:23997277-23997299 AGGGGTGGCAGAGGTGGAGGAGG - Intergenic
1005358774 6:25010322-25010344 TGGGGTGACAGAGGAGGAAAGGG - Intronic
1005454608 6:26007137-26007159 ACTTGAGGAAGAGGAGGAGAAGG - Intergenic
1005575842 6:27188508-27188530 GGCTGAGTCAGAGGAGGAGAAGG + Intergenic
1005768943 6:29045264-29045286 AGAAGAGGTAGAGGAGGAGAAGG + Intergenic
1005875106 6:30005342-30005364 AGGTGAGGAAAAGGAGTAGAGGG + Intergenic
1005893445 6:30158678-30158700 AGGGGAGGAAGAGGAGCAGAGGG - Intronic
1006302133 6:33199338-33199360 AGGGGTGGCCCAGGAGGAGAAGG + Exonic
1006670368 6:35726521-35726543 GTGTGTGGAGGAGGAGGAGATGG - Intronic
1006788073 6:36680960-36680982 AGGGGTGGTAGAAGAGGAGAGGG + Intronic
1006854601 6:37124135-37124157 GGGAGTGGAAGGGGAGGAGAGGG + Intergenic
1006923191 6:37639482-37639504 AGGTGTGGAAGGCCAGGAGAAGG - Intronic
1006984283 6:38167002-38167024 TGGTGTGGCGGAGGAGGGGGAGG - Intergenic
1007117329 6:39352176-39352198 AGGTGGGGAAGAGGAGTATAAGG - Intronic
1007307037 6:40914967-40914989 AGGTGGGGAATAGGAGGAGGAGG + Intergenic
1007524879 6:42483138-42483160 AAGTTTGGTGGAGGAGGAGAAGG - Intergenic
1007584982 6:42984052-42984074 AGGGGTTGCAGAGGAGCAAAGGG - Intergenic
1007716337 6:43858322-43858344 AGGGGTGGGGAAGGAGGAGAGGG + Intergenic
1007937313 6:45744285-45744307 AGGTGTGTCTGAGGTGGAGGTGG - Intergenic
1008383426 6:50859570-50859592 AGGTGGGGGGGAGGAGGAGGAGG - Intergenic
1009462848 6:63934744-63934766 TGTTGTGGCAGAGGGGGAGGGGG + Intronic
1009463337 6:63940829-63940851 TGTTGTGGCAGAGGGGGAGGGGG - Intronic
1009847963 6:69157602-69157624 ATGTGTGGCAGAGGGGGAGGAGG + Intronic
1009860649 6:69326770-69326792 ATGTGTGGAGGAAGAGGAGAAGG + Intronic
1010389510 6:75321039-75321061 AGAAGAGGAAGAGGAGGAGAAGG - Intronic
1010840464 6:80643754-80643776 GGGTGTGGGAGTGGGGGAGAGGG - Intergenic
1010947295 6:81990903-81990925 AGGTATGGCTGAGGAACAGAAGG + Intergenic
1011203797 6:84869182-84869204 AGGTGTGACAAAGGAGAAGAAGG - Intergenic
1011693213 6:89888212-89888234 AGGAGGGAGAGAGGAGGAGAGGG + Intergenic
1011704467 6:89987023-89987045 AAGTGTGACAGAGTAGGCGACGG - Intronic
1011714160 6:90086759-90086781 CGGAGTGGCAGAGCAGGAGAGGG + Intronic
1011806537 6:91079100-91079122 AGATGAGACAGGGGAGGAGAGGG - Intergenic
1012055472 6:94402744-94402766 TAGTGTGGTAGAGGAGCAGAAGG + Intergenic
1012521432 6:100126057-100126079 GTGGGAGGCAGAGGAGGAGAAGG + Intergenic
1012739154 6:102992453-102992475 AGAAGAGGAAGAGGAGGAGAAGG + Intergenic
1013066983 6:106693594-106693616 ACTTGTGGCAGAGGAGGTGGAGG + Intergenic
1013173994 6:107662121-107662143 CGGGGTGGCTGAGGAGGGGAAGG - Intergenic
1013322281 6:109005911-109005933 AGAAGTAGCAGAGGAAGAGAGGG + Intronic
1013372621 6:109483433-109483455 GGGCGTGGCAGGGGAGGGGAGGG + Intergenic
1013608528 6:111773362-111773384 GGGAGAGGCAGAGGAGGAGGGGG + Intronic
1013649755 6:112182630-112182652 AGGAGTAGAAGTGGAGGAGATGG + Intronic
1014506479 6:122265808-122265830 ATGTGGGACAGAGAAGGAGAGGG - Intergenic
1014670398 6:124297482-124297504 AGGAGTGGCAGAGGCAGAAAAGG + Intronic
1014732490 6:125049839-125049861 ATGTCTGGAAGAGGAGGAGCAGG + Intronic
1015018525 6:128443636-128443658 AGGTGAGGCAGAGACAGAGAAGG + Intronic
1015235138 6:130962269-130962291 AGGTGGGGCAGAGGGGAAGGAGG + Intronic
1015408819 6:132868656-132868678 AGATATGGCAGAGGCGGACAAGG - Intergenic
1015410461 6:132888095-132888117 AGGAGAGGCAGTGGAGGAGGTGG + Intergenic
1015430593 6:133126392-133126414 AGGTGTTACAGAGGAAGAGCTGG + Intergenic
1015835318 6:137414458-137414480 AGGTGTGGCAAACGGGGAGCTGG + Intergenic
1015923799 6:138290702-138290724 ATGTGCTGCAGAGAAGGAGAAGG - Intronic
1016148255 6:140703317-140703339 AGGTGTTGCAGCTGAGGAGATGG + Intergenic
1016185107 6:141189082-141189104 AGGTGTGAGGGAGGTGGAGATGG - Intergenic
1016390977 6:143574821-143574843 AATTGGGGGAGAGGAGGAGAAGG - Intronic
1016451028 6:144182409-144182431 AGGTGTGGTAAAGGAGGGAAGGG - Intronic
1016886034 6:148960312-148960334 AGGAGTGGCTGAGGCGGAGAGGG - Intronic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017412245 6:154180533-154180555 GGGTATGGAAGAGGAGGAGAAGG - Intronic
1017545375 6:155445368-155445390 AGGTGTGGAAGAAGATGTGATGG + Intronic
1017676240 6:156816995-156817017 AGGTCTGGCAGGGAGGGAGAAGG + Intronic
1017788301 6:157774245-157774267 AGGTGGGGGAGTGGAGGAGGTGG + Intronic
1017960538 6:159217184-159217206 GGGCGTGGTAAAGGAGGAGAGGG + Intronic
1018136107 6:160779795-160779817 AGGTGTAGTAGAGTAGCAGATGG - Intergenic
1018454808 6:163942060-163942082 AGTTGGGGGAGAGGAGGAAAGGG + Intergenic
1018614737 6:165676447-165676469 AGGTGCCGCAGAGGAAGAGGTGG + Intronic
1018774357 6:166999433-166999455 AGTGGTGGCCGAGGAGGACACGG + Exonic
1019009721 6:168834346-168834368 AGATGGGGGAGAGGAGGGGAAGG - Intergenic
1019136750 6:169913493-169913515 GGGTGGGGGAGAGGAGGGGAAGG + Intergenic
1019535314 7:1526247-1526269 AGGGGGGGGAAAGGAGGAGAAGG + Intergenic
1019781205 7:2940834-2940856 AGGAGAGGAAGAGGAGGAGGAGG + Intronic
1019932095 7:4230431-4230453 AGGGAGGGCACAGGAGGAGAGGG + Intronic
1019954744 7:4404754-4404776 AAGTGAGGAGGAGGAGGAGAAGG + Intergenic
1019954896 7:4405735-4405757 AGATGAGGAGGAGGAGGAGAAGG + Intergenic
1019954934 7:4405898-4405920 AGATGAGGAGGAGGAGGAGAAGG + Intergenic
1020011519 7:4808109-4808131 AGGGGAAGGAGAGGAGGAGAAGG - Intronic
1020722603 7:11766950-11766972 TGATGTGGCAGAGTAAGAGAAGG + Intronic
1021039110 7:15839474-15839496 AGGTTTGGAAGGGAAGGAGAGGG + Intergenic
1021116100 7:16748043-16748065 AGGGGAGGAAGGGGAGGAGAAGG + Intergenic
1021116112 7:16748089-16748111 AGAGGAGGAAGAGGAGGAGAAGG + Intergenic
1021365126 7:19769416-19769438 AGGTGTGTAAGAGGAAGATAAGG - Intronic
1021380579 7:19961235-19961257 AGGTGTGGAAGGAGAAGAGAGGG - Intergenic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1021835564 7:24669991-24670013 AAGTGAGGCAGGGGAAGAGAAGG - Intronic
1022125468 7:27352195-27352217 AAGTGTGGCAGAGGAAAAGTTGG - Intergenic
1022177462 7:27885411-27885433 AGGGGTGGCAGAAGTGAAGATGG - Intronic
1022324926 7:29322488-29322510 AGGTGAGGAGGAGGAGGAGTAGG - Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022515838 7:30974572-30974594 AGGCTGGGAAGAGGAGGAGAAGG + Intronic
1022638394 7:32159098-32159120 AGGTCTGGGAGACGGGGAGAGGG + Intronic
1022658089 7:32339758-32339780 AGATGAGGCAGAGCAGGAGGAGG + Intergenic
1023182138 7:37495521-37495543 AAGGGTGGGAGAGGAGGTGAGGG + Intergenic
1023217349 7:37877791-37877813 AGGTGGGGCAGAGGGGAAGGGGG - Intronic
1023355910 7:39366794-39366816 TGGGGAGGCAGGGGAGGAGATGG + Intronic
1023532747 7:41175469-41175491 AAGTGAGGCAGAGGAGGATGGGG - Intergenic
1024076213 7:45819101-45819123 AGGGGTTGGAGAGGAGCAGAAGG + Intergenic
1024093105 7:45963620-45963642 AAGTGTGGGAGAGAAAGAGAAGG + Intergenic
1024307715 7:47942219-47942241 AGGTGCTGCAGATGAGGAGAAGG - Intronic
1024522782 7:50321175-50321197 AGTTAGGGAAGAGGAGGAGAAGG + Intronic
1024720950 7:52137066-52137088 AGAGGAGGGAGAGGAGGAGAAGG + Intergenic
1025610472 7:63072390-63072412 AGATGGGGGAGAGGAGGGGAGGG - Intergenic
1025945155 7:66099406-66099428 AGGAGGAGGAGAGGAGGAGAGGG + Intronic
1026651927 7:72223180-72223202 CGGTCAGGCAGAGGAGAAGAGGG + Intronic
1026690173 7:72544223-72544245 AGGGGAGGGAGAGGAGGGGAGGG + Intergenic
1026780495 7:73263436-73263458 GGGTGTGACAAAGGAGGAGGCGG + Intergenic
1026794784 7:73359297-73359319 AGGTGGGGCAGAACAGGGGAGGG - Intergenic
1026938026 7:74270248-74270270 AGGGGAGGGAGAGGAGGGGAGGG - Intergenic
1026938032 7:74270262-74270284 AGGGGAGGGAGAGGAGGGGAGGG - Intergenic
1026938038 7:74270276-74270298 AGGGGAGGGAGAGGAGGGGAGGG - Intergenic
1027021354 7:74816877-74816899 GGGTGTGACAAAGGAGGAGGCGG + Intronic
1027066672 7:75129060-75129082 GGGTGTGACAAAGGAGGAGGCGG - Intronic
1027224160 7:76233599-76233621 AGGTGTGGGAGTGGAAAAGAGGG + Intronic
1027270148 7:76514477-76514499 AGGTGAGGCCCGGGAGGAGAAGG - Intronic
1027270381 7:76515474-76515496 AGGTGAGACAGAGGTGGGGATGG - Intronic
1027304215 7:76875657-76875679 TGCTGTGCCACAGGAGGAGATGG + Intergenic
1027542984 7:79491802-79491824 AGGGGTGGCAGAGGTGGAAAAGG + Intergenic
1027749659 7:82126844-82126866 GGGTGTTGCAGCTGAGGAGATGG - Intronic
1028058346 7:86277237-86277259 AGGGGTGGCAGAAGAGGAAGAGG - Intergenic
1028342608 7:89740685-89740707 AGGTGTGTTAGGGGAGGAGATGG - Intergenic
1028983720 7:96993860-96993882 AGGTGTGGCTGGGGATGAGGTGG - Intergenic
1029023665 7:97391514-97391536 AGGTGCTGCAGTGAAGGAGATGG - Intergenic
1029165506 7:98586862-98586884 AGGTTTGGCAGAGGTGGAAGAGG + Intergenic
1029347569 7:99989646-99989668 AGGTGTGGGGCAGGAGGAGAGGG + Intergenic
1029641701 7:101824686-101824708 AGGCTTGGCAGGGCAGGAGAAGG - Intronic
1029675960 7:102069101-102069123 GGGTGTCGAGGAGGAGGAGAGGG - Intronic
1029868793 7:103665421-103665443 AGGTGTGGCTGAGGGACAGAGGG - Intronic
1030148798 7:106382325-106382347 AGAGGAGGAAGAGGAGGAGAAGG + Intergenic
1030259664 7:107549760-107549782 AGGTCTGACAGAGGAGAAGTGGG - Intronic
1030305363 7:108012873-108012895 TGGCTTGGCAGAGAAGGAGAAGG - Intergenic
1031060700 7:117048199-117048221 AGGGGTGGCAGAGATGGAGGAGG + Intronic
1031681604 7:124681431-124681453 AGGGGTAGCAGAGGTGGAGGAGG - Intergenic
1031917188 7:127574639-127574661 AGCTGTGGCAGGGGAGGAAAGGG + Intergenic
1031973568 7:128080253-128080275 AGGTCTGTCAGAGCAGGGGAGGG - Intronic
1032044761 7:128595707-128595729 AGAAGAGGAAGAGGAGGAGAAGG - Intergenic
1032130637 7:129224947-129224969 GGGGGTGGGAGAGGAGGCGATGG + Intergenic
1032300329 7:130680558-130680580 AGGTGTGGGTGAGGAAGGGACGG + Intronic
1032364716 7:131288090-131288112 GAGTGTGGCAGAGAAGGACATGG - Intronic
1032364783 7:131288590-131288612 GAGTGTGGCAGAGAAGGACATGG - Intronic
1032704010 7:134406470-134406492 AGAGGTGGCAGAGGATGAGGGGG - Intergenic
1033085358 7:138336325-138336347 CGGGGTGGCAGAGGAGGAAGAGG - Intergenic
1033268526 7:139909979-139910001 AGGGGTGACAAAGGAGGTGAGGG - Intronic
1033350456 7:140558019-140558041 TGATGAGGCACAGGAGGAGAAGG - Intronic
1033607889 7:142940769-142940791 AGGTGTGGGAGAGAAGGATGTGG - Exonic
1033682437 7:143608048-143608070 AGTTGGGGGAGAGTAGGAGAGGG - Intergenic
1033702452 7:143853865-143853887 AGTTGGGGGAGAGTAGGAGAGGG + Exonic
1034277632 7:149830603-149830625 AGGGGAGGCACAGGAGGAGGAGG - Intergenic
1034277694 7:149830839-149830861 AGGGGAGGCACAGGAGGAGGAGG - Intergenic
1034277717 7:149830918-149830940 AGGGGAGGCATAGGAGGAGGAGG - Intergenic
1034422325 7:150996301-150996323 AGGGGTGGAACAGGGGGAGAGGG - Intronic
1034451595 7:151139923-151139945 AAGGGAGGCAGAGGAGGGGAGGG - Intronic
1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG + Intronic
1034908713 7:154973994-154974016 AGGTGGGGCAGAGCAAGAGGAGG - Intronic
1035041915 7:155935253-155935275 AAGTGAGGAAGAGGAGAAGAAGG - Intergenic
1035170820 7:157016640-157016662 AGCTGTGGCAGTGGGGGAGGGGG + Intergenic
1035239557 7:157520903-157520925 AGGGGAGGAAGAGAAGGAGAGGG + Intergenic
1035280867 7:157777019-157777041 AGGTAGGGAGGAGGAGGAGAGGG - Intronic
1035291889 7:157844507-157844529 AGGTGAGGGCCAGGAGGAGAGGG + Intronic
1035460230 7:159034093-159034115 AGGTGTGACAGTGGCGGAGGCGG + Intronic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1035811655 8:2496611-2496633 AGGAATGGCAGAGGAAGAGAAGG + Intergenic
1036295191 8:7529178-7529200 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1036327379 8:7791840-7791862 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1036518915 8:9472323-9472345 AGGTGCTCCAGTGGAGGAGATGG - Intergenic
1036631527 8:10519182-10519204 GGATGTGGAAGAGTAGGAGAAGG - Intergenic
1036765586 8:11547617-11547639 AGGCGGGGCAGAGGAGGAAAAGG + Intronic
1036784530 8:11677182-11677204 AGGTGGGGGAGGGGAGGGGAAGG + Intronic
1037013404 8:13873394-13873416 AGGGGTGGCAGAGGTGGAAGAGG + Intergenic
1037587615 8:20288764-20288786 AGGGGAGGCAGAGGAGGGGCAGG - Intronic
1037615131 8:20512308-20512330 AGCTCTGGCACAGGAGCAGAAGG + Intergenic
1037800693 8:22033759-22033781 AGGGGAGGAAGAGGAGGAGAGGG - Intronic
1038214131 8:25546140-25546162 GGGTGCTACAGAGGAGGAGATGG + Intergenic
1038338723 8:26666188-26666210 AGTAATGGCAGAGGAGCAGAAGG - Intergenic
1038416924 8:27403919-27403941 AGAGGAGGCAGAGAAGGAGAAGG - Intronic
1038782354 8:30579149-30579171 CTGGGTGGCAGAGCAGGAGAAGG - Intronic
1039288018 8:36063833-36063855 AGGTGTGCCAGTGGAGGGAATGG + Intergenic
1039436642 8:37564105-37564127 AGGTGTGGCTGTGGAGGAAATGG - Intergenic
1040071942 8:43195674-43195696 GGGTGTGGATGAGGAGGAGGAGG + Intronic
1040522800 8:48192834-48192856 AGGAGAGGAGGAGGAGGAGAAGG + Intergenic
1040959049 8:53011545-53011567 AGGTGTAGGATAGGAGGAGGAGG + Intergenic
1041267613 8:56080351-56080373 AGGGGAGGAGGAGGAGGAGAAGG + Intergenic
1041669159 8:60475618-60475640 AGGTGAAGAAGGGGAGGAGAGGG - Intergenic
1041713978 8:60916937-60916959 GGGTGGGGCAGAGAAGCAGAAGG + Intergenic
1041729231 8:61048257-61048279 ATGTGTGGCAGAGCAGGGCATGG + Intergenic
1041860777 8:62510397-62510419 TGGAGTGGAAGAAGAGGAGAAGG - Intronic
1042397283 8:68307038-68307060 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1042483838 8:69330802-69330824 AGGAGTGGCAGCCCAGGAGATGG + Intergenic
1042987956 8:74604447-74604469 AGGTGGGGTGGAGGAGGAGGAGG + Intronic
1043057229 8:75454113-75454135 GAGTGGGGGAGAGGAGGAGAGGG - Intronic
1043499556 8:80838862-80838884 AGTGGTGGCGGAGAAGGAGAAGG + Intronic
1043532054 8:81161673-81161695 AGGAGAGGAAGAGGAAGAGAGGG + Intergenic
1043602417 8:81956786-81956808 AGGGGAAGGAGAGGAGGAGAGGG + Intergenic
1043647659 8:82541272-82541294 TGGTGAGGGAGAGGAGAAGATGG + Intergenic
1043868209 8:85399823-85399845 AGGTGAGAGAGAGGAGGAGGAGG + Intronic
1045055213 8:98362803-98362825 AGGTGTGGCTAAGGAAGTGAAGG - Intergenic
1045147017 8:99357181-99357203 AGGTGAGGTAGAGGAAGAAAGGG - Intronic
1045170056 8:99655637-99655659 AGCTGGGGCAGAGGATGGGAAGG - Intronic
1045491283 8:102671282-102671304 AGGAGTGGGAGAGGAGAAGTGGG - Intergenic
1045812382 8:106237948-106237970 AGGAGTAGGGGAGGAGGAGAAGG + Intergenic
1046106101 8:109668142-109668164 AGAAGAGGCAGAGGGGGAGAGGG + Intronic
1046417106 8:113931954-113931976 AGATGGGGAAGAGGAGGAGGAGG - Intergenic
1046593319 8:116231395-116231417 GGGTGTAGCAGAGGAGGGGCTGG - Intergenic
1046695235 8:117332558-117332580 AGGTTTTGCAGATGAGGAAATGG - Intergenic
1046971750 8:120230651-120230673 AAGTGTCACAGAGGAGGAGGGGG - Intronic
1047076016 8:121403904-121403926 GGTTGTGGCAGAGAAGGAGGTGG + Intergenic
1047120508 8:121898838-121898860 AGGTGGGGGAGAGGGAGAGACGG - Intergenic
1047308182 8:123670194-123670216 AGGTGGGGAGGAGGAGGAGGAGG - Intergenic
1047358031 8:124141750-124141772 AGGTGCTGCAGAGCAGGAGGTGG + Intergenic
1047512676 8:125527812-125527834 TGGTGTGGCAGAGCAGGAACTGG - Intergenic
1047526427 8:125638117-125638139 GGGGGTGGGAGAGGAGGGGAGGG + Intergenic
1047701384 8:127452667-127452689 AGGGGAGGAAGAGGAGGAGGAGG + Intergenic
1047793296 8:128227968-128227990 AGGGGTGGGAGAAGGGGAGAAGG - Intergenic
1047812382 8:128424803-128424825 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1047868013 8:129050274-129050296 AGGAGTGGCAGAGGATGAAGAGG - Intergenic
1047964105 8:130032960-130032982 AACTCTGACAGAGGAGGAGAAGG + Intergenic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048199869 8:132363442-132363464 TGGTGTGGCAAAGGAGGAAGGGG + Intronic
1048383455 8:133889047-133889069 AGGTGCAGAATAGGAGGAGATGG + Intergenic
1048518908 8:135136088-135136110 AGGGGAGGAAGAGGAGGAAAAGG + Intergenic
1048964280 8:139604095-139604117 AGGAGGAGCAGAGGAAGAGAAGG + Intronic
1048971770 8:139649093-139649115 AGGTGTGGGAGGGGAGGCCACGG - Intronic
1049026486 8:139994196-139994218 AAGTGGGGCAGCAGAGGAGAAGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049248779 8:141577184-141577206 ACGAGGGGCAGGGGAGGAGATGG - Intergenic
1049337596 8:142094654-142094676 AGGTGTGGGAGCGGAGGAGCAGG - Intergenic
1049385635 8:142341643-142341665 TGGTGTGGAAGAAGAGGAGGTGG - Intronic
1049386093 8:142343838-142343860 AGGGGAGGAAGAGGAGGAGGAGG + Intronic
1049443796 8:142620909-142620931 TGGTGTGGCAGAGGGTGAGGAGG + Intergenic
1049779944 8:144424336-144424358 AGCTGTGGCTGAGGAGGGGTTGG - Intronic
1050415991 9:5418514-5418536 GGGGGTGGCGGAGGAGGAGCAGG - Intronic
1050517609 9:6461356-6461378 AGGAGGGGGAGAGGAGGAGGGGG - Intronic
1051120470 9:13746641-13746663 AGGTGGGGTAGAGGAAGACAAGG + Intergenic
1051148773 9:14058488-14058510 GGATATGGCAGAGGAGGAGAAGG + Intergenic
1051642740 9:19238573-19238595 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1052156005 9:25191570-25191592 AGGTGTGGCAGAGGCAGAAGAGG - Intergenic
1052442048 9:28510539-28510561 AGGGGTGGCAGAGGCAGAGGAGG + Intronic
1052872670 9:33523756-33523778 AGCTCTGGCAGAGGAGGAGCCGG + Intergenic
1052925923 9:34016236-34016258 AGGGGAGGAAGAGGAGGAGGAGG + Intronic
1053104508 9:35398489-35398511 GGGTGTGGCAGGGTAGAAGAGGG + Intronic
1053276654 9:36788311-36788333 AGTGGTGGGAGATGAGGAGAAGG + Intergenic
1053329246 9:37188665-37188687 AGGTGAGATAGGGGAGGAGAGGG - Intronic
1053345000 9:37371609-37371631 AGGTGTGGCAGGAGACGAGCAGG - Intergenic
1053752292 9:41269097-41269119 AGCTCTGGCAGAGGAGGAGCCGG - Intergenic
1053752742 9:41273354-41273376 AGCTCTGGCATAGGAGGAGCCGG - Intergenic
1054257818 9:62833429-62833451 AGCTCTGGCAGAGGAGGAGCCGG - Intergenic
1054258267 9:62837706-62837728 AGCTCTGGCATAGGAGGAGCCGG - Intergenic
1054333504 9:63782335-63782357 AGCTCTGGCATAGGAGGAGCCGG + Intergenic
1055091027 9:72364935-72364957 AGGGGGGGCCGAGGAGGAGGTGG + Intronic
1055640413 9:78315011-78315033 AGGTGTGGGAGAGGAGCAGTTGG + Intronic
1055764824 9:79651314-79651336 AAGTGGGGGAGAGGAGGAGTTGG - Intronic
1055928072 9:81531211-81531233 AGGTTTGGAAGAGGATGGGAAGG + Intergenic
1056530057 9:87478951-87478973 GGGTGTGAGAGAGGAGGTGAAGG + Intergenic
1056531593 9:87492914-87492936 AGGTGTGGGAGAGGTGCAGGGGG + Intergenic
1056606285 9:88088385-88088407 AAGTGTGAAAGAGGAAGAGAAGG - Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1056806587 9:89733522-89733544 AGAAGAGGAAGAGGAGGAGAAGG - Intergenic
1057053809 9:91946449-91946471 GGGTGTGGAAGAGGAGGAGGAGG + Intronic
1057224331 9:93281066-93281088 AGGCGTGGCAGGAAAGGAGAGGG + Intronic
1057497386 9:95571883-95571905 AGGAGAGGGGGAGGAGGAGAGGG + Intergenic
1057497392 9:95571897-95571919 AGGAGAGGGGGAGGAGGAGAGGG + Intergenic
1057527362 9:95814958-95814980 TGGGATGGGAGAGGAGGAGATGG + Intergenic
1057579436 9:96273401-96273423 AGGTGTGCCAGACTGGGAGATGG - Intronic
1057684778 9:97222069-97222091 AGCTCTGGCAGAGGAGGAGCCGG - Intergenic
1057842137 9:98494989-98495011 AGGGTTGGGAGAGGAGGGGAGGG - Intronic
1058269309 9:102950074-102950096 TGGTGAGGCTGAGGAGGAAAGGG - Intergenic
1058421716 9:104838889-104838911 AGCTGGGGGAGAGGAGGAGATGG + Intronic
1058452829 9:105113092-105113114 AGGAGAGGAAGAGGAGGAGGAGG + Intergenic
1058618798 9:106862562-106862584 GGGGGAGGAAGAGGAGGAGAAGG - Intergenic
1058715950 9:107722171-107722193 AGGGGGGGAAGAGGAGGAGGAGG - Intergenic
1058936199 9:109771893-109771915 TGGGGTGGGAGGGGAGGAGAGGG - Intronic
1059164904 9:112068318-112068340 AGGTCTGGCAGAGTAGAAGTAGG + Intronic
1059296641 9:113276616-113276638 AAGTTTGGAAGAGAAGGAGAGGG + Exonic
1059534571 9:115069490-115069512 GGGAATGGGAGAGGAGGAGAGGG + Intronic
1059663099 9:116420826-116420848 AGAGGAGGGAGAGGAGGAGAAGG + Intergenic
1059810493 9:117851426-117851448 AGGAGGAGGAGAGGAGGAGAAGG - Intergenic
1059891561 9:118810300-118810322 AGCAGTGGCAAAGGTGGAGATGG + Intergenic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060672863 9:125485639-125485661 AGGTCTGGGTGAGGATGAGAGGG - Intronic
1060782298 9:126421839-126421861 AGATGTGCCTGAGGAAGAGAAGG - Exonic
1060891607 9:127192771-127192793 AGGGGTGTTAGAGGAAGAGAAGG + Intronic
1061040919 9:128139855-128139877 AGGGGGGGAAGAGGCGGAGAGGG + Intergenic
1061256376 9:129455996-129456018 AGGAAGGGCAGGGGAGGAGAGGG - Intergenic
1061396647 9:130347230-130347252 AGGTGTGGCAGTGCTGGAGGAGG + Intronic
1061538772 9:131266130-131266152 GGTGGAGGCAGAGGAGGAGAAGG - Intronic
1061808633 9:133149760-133149782 AGGTGGGGAAGAGGAGGGGAAGG - Intergenic
1061926503 9:133808472-133808494 AGGTGGGGTAGGGGAGGTGAAGG + Intronic
1062211796 9:135368664-135368686 GGGTGTTGCAGCCGAGGAGAGGG - Intergenic
1062278303 9:135740899-135740921 AGGGGTGGGAGGGGAGGGGAGGG - Intronic
1062474032 9:136718857-136718879 AGATGTGGCAGTGGAGGACTGGG + Intronic
1062729450 9:138100986-138101008 AGGCGTGGCGGCGGAGGTGAGGG - Intronic
1202800506 9_KI270719v1_random:170669-170691 AGCTCTGGCAGAGGAGGAGCCGG + Intergenic
1202800952 9_KI270719v1_random:174951-174973 AGCTCTGGCAGAGGAGGAGCCGG + Intergenic
1203697064 Un_GL000214v1:108955-108977 AGCTCTGACAGAGGAGGAGCCGG - Intergenic
1203360773 Un_KI270442v1:217992-218014 TGGTGTGGCAGAGGCGAGGATGG + Intergenic
1203552145 Un_KI270743v1:172074-172096 AGCTCTGACAGAGGAGGAGCCGG + Intergenic
1185581360 X:1213223-1213245 AGGTGGGGAGGAGGAGGGGAGGG - Intergenic
1185870928 X:3664194-3664216 TGGTGTGGAAGTGGAGGAAAGGG - Intronic
1186266435 X:7839235-7839257 AGGTACGGGAGAGGAAGAGAAGG + Intergenic
1186424813 X:9455575-9455597 AGGAGAAGGAGAGGAGGAGAAGG - Intergenic
1186693704 X:12006660-12006682 AGATGTGGCAGCTGTGGAGAAGG - Intergenic
1186760952 X:12721111-12721133 TGGTGAGGAAGAAGAGGAGAGGG + Exonic
1186857458 X:13639891-13639913 CTGTGTGGCAGAGGAGTGGAGGG - Intergenic
1187102407 X:16207611-16207633 AGAGGTGGAAGAGGTGGAGAAGG + Intergenic
1187243176 X:17531567-17531589 AGCAGTGGCAGAGGAGGAGGGGG - Intronic
1187293910 X:17980933-17980955 AGAAGGGGCAGGGGAGGAGAGGG - Intergenic
1188513431 X:30960353-30960375 AGGTGAGGCAGATGAGGATCTGG + Intronic
1189193771 X:39134605-39134627 TGATGTGGCAGAGGAAGAGGAGG - Intergenic
1189230469 X:39448398-39448420 AGGTGAGGGGAAGGAGGAGAGGG + Intergenic
1189239588 X:39515348-39515370 AGGTGTGGCACAGGAGGGGCGGG - Intergenic
1189266183 X:39718356-39718378 AAATGTTGCAGAGGAGGAGGAGG + Intergenic
1189740846 X:44115932-44115954 AAACCTGGCAGAGGAGGAGAAGG - Intergenic
1189858926 X:45252330-45252352 CCATGTGGCAGAGGAGGAAAGGG - Intergenic
1189953498 X:46255968-46255990 AGGGTAGGAAGAGGAGGAGAAGG + Intergenic
1190179214 X:48177476-48177498 AGGAGAGGGAGAGGAGGGGAGGG + Intergenic
1190190682 X:48274514-48274536 AGGGGAGGGGGAGGAGGAGAAGG + Intronic
1190260400 X:48793543-48793565 AGGTGGGGGAGAGGAGAGGAAGG - Intronic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1190618724 X:52264428-52264450 AGGTGTGTCAGAGAAGTGGAAGG + Intergenic
1190625888 X:52338051-52338073 AGGTGTGTCAGAGAAGTGGAAGG - Intergenic
1191672432 X:63760698-63760720 AGGTGAGGGGGAGGAGGAGAAGG + Intronic
1192233005 X:69278650-69278672 TGGGGTGGGAGAGGTGGAGAAGG - Intergenic
1192246174 X:69373512-69373534 TGGAGTGGGAGAGGAGGAGAGGG - Intergenic
1192460978 X:71317169-71317191 AGGAGTGGAACAGGAGGAGTTGG - Intergenic
1192547575 X:72026752-72026774 ATGTGTGCCAGGGGAGGAGGTGG - Intergenic
1192677482 X:73213841-73213863 TGCTGTGGAAGAGGAGGAGGAGG - Exonic
1193894694 X:87098698-87098720 AAGTGGGGGAGAGGAGGGGAGGG + Intergenic
1194085091 X:89516479-89516501 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1195238363 X:102925347-102925369 AGGTGAGGGAGAGGTGGGGATGG - Intergenic
1195392398 X:104376322-104376344 AGGTGTGGCAGAGGTGGAAGAGG - Intergenic
1196580021 X:117367925-117367947 ACGTAGGGGAGAGGAGGAGAGGG + Intergenic
1196665119 X:118307961-118307983 AGGTGGTGCAGCTGAGGAGATGG + Intergenic
1196900041 X:120373920-120373942 AGAAGAGGAAGAGGAGGAGAAGG - Intronic
1196918114 X:120560435-120560457 AGGAGTGGAAGAGGAGGAAGAGG + Exonic
1196990618 X:121324937-121324959 AAGTGGGGGAGAGGAGGAGGAGG + Intergenic
1197006414 X:121507340-121507362 AGGTGTGGCAGAGGTGGAAGAGG - Intergenic
1197082005 X:122429647-122429669 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1197335335 X:125204497-125204519 AGGAGAGGGAGAGGAGGAGGAGG + Intergenic
1198070748 X:133146113-133146135 AGGGGTGGCAGAGGCAGAAATGG + Intergenic
1198097040 X:133390257-133390279 AGGTGGGTGAGAGGAGGAAAGGG - Intronic
1198114118 X:133528481-133528503 AGGGGTGGGAAGGGAGGAGAGGG - Intergenic
1198611189 X:138402444-138402466 AGGTGAGGGAAAGGAGGAGAAGG + Intergenic
1198651961 X:138872899-138872921 AGGGGTGGAAGAGGGGGACAAGG + Intronic
1199614097 X:149641632-149641654 AGGGCTGGCAGAGGAGGAAGAGG + Intergenic
1199650798 X:149944856-149944878 AGGAGGAGCAGAGGAGGAGGAGG + Intergenic
1199650884 X:149945287-149945309 AGGAGGAGGAGAGGAGGAGAAGG + Intergenic
1199715876 X:150506998-150507020 GGGTGTGACAGAGGAAGAGCTGG + Intronic
1199760102 X:150898644-150898666 AGGGGAGGCCGAGGAGGAGCGGG + Exonic
1199788709 X:151129735-151129757 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1200160365 X:154004667-154004689 TGGTGTGGAGGAGGAGGAGGAGG + Intergenic
1200360364 X:155598965-155598987 AGGAGTGGCAGAGGTGGAAGGGG - Intronic
1200390485 X:155940363-155940385 AGCTGTGGTAGAGGAGAAGCAGG - Intronic
1200437739 Y:3172363-3172385 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1200754116 Y:6973794-6973816 AGTGGGGGCAGAGGAGGAGAGGG - Intronic
1201061360 Y:10049507-10049529 AGGTGTGGTAGAATAGCAGATGG + Intergenic
1201153427 Y:11107647-11107669 AGCTATGGCAGAGGAGGAGACGG + Intergenic
1201638791 Y:16156044-16156066 AGAGGTGGCAGAGAAGCAGAGGG - Intergenic