ID: 993658899

View in Genome Browser
Species Human (GRCh38)
Location 5:90606074-90606096
Sequence ATGCTTTTAATGATCATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993658899_993658903 16 Left 993658899 5:90606074-90606096 CCTTGTATGATCATTAAAAGCAT 0: 1
1: 0
2: 1
3: 12
4: 209
Right 993658903 5:90606113-90606135 TTTGGCTTGTATTCAAGCTTGGG No data
993658899_993658902 15 Left 993658899 5:90606074-90606096 CCTTGTATGATCATTAAAAGCAT 0: 1
1: 0
2: 1
3: 12
4: 209
Right 993658902 5:90606112-90606134 TTTTGGCTTGTATTCAAGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 153
993658899_993658900 -2 Left 993658899 5:90606074-90606096 CCTTGTATGATCATTAAAAGCAT 0: 1
1: 0
2: 1
3: 12
4: 209
Right 993658900 5:90606095-90606117 ATAGTCCACACACTACTTTTTGG 0: 1
1: 0
2: 1
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993658899 Original CRISPR ATGCTTTTAATGATCATACA AGG (reversed) Intronic
900816034 1:4846605-4846627 ATGTTCTTAATGAGTATACAAGG - Intergenic
901648937 1:10732387-10732409 ATACTTTTTAAGATCATAAAGGG + Intronic
905785453 1:40752978-40753000 ATACTTTAAATGATCAGACCTGG - Intronic
905928106 1:41766319-41766341 ATGTTGTTAACTATCATACAAGG + Intronic
905951719 1:41957514-41957536 ATGCTTTTATAGAGCATAAAGGG - Intronic
907353383 1:53852047-53852069 ATGCTCGCAATGATCATCCATGG + Exonic
907510390 1:54953759-54953781 AAGCTCTTAATATTCATACAAGG + Intergenic
908172405 1:61518815-61518837 ATGTTTTCAATGTTCATCCATGG + Intergenic
908857423 1:68446354-68446376 ATGCTTGTAATGAATATATAAGG + Intronic
908989379 1:70067861-70067883 ATTTTTTGAATGATTATACATGG + Intronic
910643567 1:89489865-89489887 ATGCTGTTGATGTTCATTCAAGG - Intergenic
911990422 1:104689329-104689351 ATGCTGTTAATAATCATAATAGG - Intergenic
912124734 1:106521338-106521360 ATGATTTTATTTATCATATATGG + Intergenic
912201448 1:107462431-107462453 ATCCTTTTAACAATCTTACAAGG - Intronic
913517783 1:119619012-119619034 GTGATTTTAATGAGCAAACAGGG - Intergenic
913688642 1:121257538-121257560 CTGCTTTTAATCATCTTCCAAGG + Intronic
914148957 1:145022738-145022760 CTGCTTTTAATCATCTTCCAAGG - Intronic
914808933 1:151012381-151012403 GTGCTATTAATGATTACACAGGG - Intronic
918192160 1:182186077-182186099 CTGCTTTTGAGGATAATACATGG - Intergenic
920475966 1:206276039-206276061 CTGCTTTTAATCATCTTCCAAGG + Intronic
922226259 1:223648394-223648416 ATCCTTTTAATGAGCAGTCAGGG - Intronic
1066516890 10:36172498-36172520 ATTCTTTTAATTTTCAGACAAGG + Intergenic
1067422981 10:46174060-46174082 ATTCATTTAATGAGTATACACGG + Intergenic
1068217229 10:53998538-53998560 ATCTTTTTAATGATCATGCTAGG + Intronic
1069079615 10:64074372-64074394 GTGCTTTTAATTTTCATACTAGG - Intergenic
1069411560 10:68159216-68159238 ATGCTATTAATAATTATACAGGG + Intronic
1072830310 10:98650489-98650511 ATCTTTTTAATTTTCATACAAGG - Intronic
1073554066 10:104430927-104430949 TTGCTTTAAATGTTAATACATGG - Intronic
1073660810 10:105474162-105474184 ATAATTATAATGATCATCCAAGG + Intergenic
1075915624 10:126163964-126163986 TTGCTTACACTGATCATACAGGG + Intronic
1077806147 11:5593038-5593060 ATGCTTCTGATCATCAAACATGG - Intronic
1078469448 11:11575390-11575412 AAGCTTTTCCTGATCATCCAAGG + Intronic
1079354453 11:19718148-19718170 ATGCTATAAATGTTCATACTTGG - Intronic
1080079915 11:28204724-28204746 ATGATTGTAATGATGATATAAGG + Intronic
1080196309 11:29613506-29613528 ATTCATTTACTCATCATACATGG + Intergenic
1086596319 11:88575730-88575752 ATGTTCTGAATGATCATTCATGG + Intronic
1088608891 11:111558413-111558435 ATCCTTATAATAATCCTACAAGG - Intronic
1094032813 12:26032724-26032746 CTGCTTTAAATGATTATAGATGG - Intronic
1094442577 12:30494980-30495002 AGGATTTTAATGATGCTACATGG - Intergenic
1096302688 12:50445420-50445442 ATGCTTTTACTTATTATACTTGG + Intronic
1097374345 12:58822755-58822777 ATGATTTAAGTTATCATACATGG - Intergenic
1098481927 12:70972347-70972369 ATACATGTAATGATCATTCATGG - Intergenic
1099227683 12:79989447-79989469 ATCCTTTTCATGGTCATCCATGG + Intergenic
1099463609 12:82955153-82955175 ATGCTTTTAAACATCTTACAAGG - Intronic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1104219203 12:126765936-126765958 ATGGTTTTAAAAATCATACCAGG + Intergenic
1105562694 13:21509236-21509258 ATGTTTATAATAATCATATAAGG + Intronic
1106595706 13:31133957-31133979 ATGCTGTTAAACATCCTACAAGG + Intergenic
1106972306 13:35156305-35156327 ATACTTTTAATCATCAGAAAAGG + Intronic
1107161331 13:37232123-37232145 ATGCTGTTAATGATAATAATAGG - Intergenic
1112228901 13:97568279-97568301 TTGTTTTTGATGATCATTCAGGG - Intergenic
1112816289 13:103277586-103277608 ATGCTTTTGATGATGATAATAGG - Intergenic
1112999901 13:105622490-105622512 ATCCTATTAATGAGCATAAATGG - Intergenic
1113182694 13:107649712-107649734 TTCCTTTTAATTATCATTCAAGG - Intronic
1113745209 13:112739826-112739848 ATGCTTTCAAAGTTCATTCATGG - Intronic
1114674964 14:24433832-24433854 ATGGTTTGAATGAAAATACAAGG + Intronic
1115679294 14:35718508-35718530 ATGTTTTTCATGAACGTACATGG - Intronic
1116757162 14:48962357-48962379 ATGCTGTTATATATCATACACGG + Intergenic
1116798788 14:49420439-49420461 ATGCTTTTATTCATCAGACTTGG - Intergenic
1117408043 14:55423842-55423864 AGGCTTTTAATGGCCACACAAGG - Intronic
1117783882 14:59262406-59262428 ATGTTTTTAATGATGATAGAGGG - Intronic
1119616177 14:76100564-76100586 TTGCGTTTAATAATCATACCAGG + Intergenic
1120071162 14:80104918-80104940 ATGATTTTGATGCTCAGACAAGG + Intergenic
1127543049 15:59962181-59962203 ATGTTTTTAAGATTCATACATGG - Intergenic
1127543259 15:59964475-59964497 ATGTTTTTAAGATTCATACATGG - Intergenic
1128485839 15:68087158-68087180 ATGGTTTTAATGATCATAAAAGG + Intronic
1128505943 15:68272808-68272830 ATGCTTTTAATGACCATGTTTGG + Intergenic
1128550689 15:68596328-68596350 ATGCTGTTAAAGAAAATACAGGG + Intronic
1128962324 15:72020138-72020160 ATTTTTTTAATGGTCATAAAGGG + Intronic
1130158266 15:81372552-81372574 ATGCTTGTAATGATCAATAATGG + Intronic
1130655196 15:85787605-85787627 AAGATTTCATTGATCATACAGGG + Intronic
1130740519 15:86594547-86594569 ATGCTTTTTATAATGATATAAGG + Intronic
1137427939 16:48395469-48395491 ATGCTTTTAATGAGCACAACGGG + Intronic
1139280722 16:65768107-65768129 CTGCTTTTAATGAGCAATCAGGG - Intergenic
1139336599 16:66236338-66236360 ATGGTTTTAATGAGCAGCCAAGG + Intergenic
1141213482 16:82002514-82002536 ATCCTTTTAATAATCTTACTAGG + Intronic
1142297882 16:89238775-89238797 ATGTTTTTACTGATTCTACAGGG - Intergenic
1143707987 17:8713588-8713610 ATCTTCTTAATGATCTTACACGG - Intergenic
1143804624 17:9416137-9416159 ATGCTTTTAATGTGCAACCAGGG - Intronic
1146227660 17:31080803-31080825 ATGCTTTCAAGGTTCATCCATGG + Intergenic
1148226181 17:45899256-45899278 ATGCTGTTAAACATCCTACAAGG + Intronic
1149400267 17:56288908-56288930 ATGAATTTAATTATCATCCACGG + Intronic
1150903570 17:69312150-69312172 ATGCTATTAATGATTAAACAAGG - Intronic
1152602078 17:81268640-81268662 ATTCTTCTAATGATTATACTAGG - Intronic
1153231513 18:2941365-2941387 ATGCTTTTAAGATTCATAAAAGG + Intronic
1157180059 18:45489067-45489089 ATGGTTTTGATTATCCTACATGG + Intronic
1159933316 18:74337200-74337222 ATGGTTTTAGTCATCATATAAGG + Intronic
1160235422 18:77082297-77082319 ATGCTTTCAAGGCTCATCCATGG - Intronic
1164268430 19:23644876-23644898 TTGCTTTTAATCATTTTACAAGG + Intronic
1165868371 19:38952993-38953015 ATGTTTTTAATGATTAACCATGG - Intronic
925575198 2:5352894-5352916 ATGTTTTTGAATATCATACAAGG - Intergenic
925811515 2:7705908-7705930 AAGATCTTAATGATCATAAATGG + Intergenic
925864591 2:8215642-8215664 ATGCTATTAATAATTATTCAAGG + Intergenic
926329172 2:11810665-11810687 ATGCTTTTGATGGACATAAAGGG + Intronic
926428449 2:12761763-12761785 TGGCTTTAAATGATCATATATGG + Intergenic
926710797 2:15878512-15878534 ATGCATTTATTGATCATAAAAGG - Intergenic
928535692 2:32238988-32239010 ATGATTTTAATGACCAGGCATGG + Intronic
929020075 2:37544784-37544806 ATGCTGTTAAACATCCTACAAGG - Intergenic
930187698 2:48426813-48426835 ATGCTTTAAAAGATCATTCTGGG + Intergenic
932608363 2:73179198-73179220 ATGCTTTTAAACTTCATATATGG - Intergenic
932945858 2:76229671-76229693 ATGGCTTTAATGAACACACATGG + Intergenic
932946242 2:76235168-76235190 ATGGCTTTAATGAACACACATGG - Intergenic
933509111 2:83217450-83217472 ATGCATTTAAGGAATATACAAGG + Intergenic
936924340 2:117721382-117721404 ATCCTTTTAATCACCATCCAGGG - Intergenic
937715067 2:125023147-125023169 ATGCTTTCTTTGAACATACAAGG + Intergenic
940253949 2:151709407-151709429 ATGTTATTAATGCTCATACATGG + Intronic
940308740 2:152254539-152254561 ATGATTCTAATGATCAACCATGG - Intergenic
941228712 2:162881987-162882009 ATGCTACTAATTATTATACAAGG + Intergenic
942244582 2:173995404-173995426 ATGCTTTTAATGATCTTCACTGG + Intergenic
943036528 2:182753294-182753316 ATGTTTTTAAAGAACATAGATGG + Intronic
943728687 2:191279182-191279204 ATGTTTTTCATGATAATTCAGGG + Intronic
944659962 2:201913300-201913322 ACGCTGTTAATGGTCCTACATGG - Intergenic
945015071 2:205506736-205506758 ATGCTTTTAAGGAGGAGACAAGG - Intronic
947870068 2:233430267-233430289 ATGCTTGTAAAGATAATTCACGG + Intronic
948315916 2:237028286-237028308 ATGCTCTTACTGGTCATACAGGG + Intergenic
1173969960 20:47145145-47145167 ATCCTTTTTATTATCATAAATGG - Intronic
1176727853 21:10457232-10457254 ATTGTTTTCATGATGATACAAGG + Intergenic
1179874335 21:44260398-44260420 ATGCTTTAAATGAAGCTACAGGG + Intronic
1180286540 22:10749816-10749838 ATTATTTTCATGATGATACAAGG - Intergenic
1184078687 22:42201878-42201900 ATGCTTTTACTTAACATGCAAGG + Intronic
1185047907 22:48538106-48538128 ATGGTTTTAATCATCTTAAAGGG + Intronic
953735855 3:45493404-45493426 ATGATCTTAATGAGCATCCAAGG + Intronic
956623495 3:71244709-71244731 GTGCTTTTAATTGTCATGCATGG - Intronic
958574706 3:95933903-95933925 ATTCTCTTAAGGATCAGACATGG - Intergenic
958597452 3:96245814-96245836 ATGCTTTTATTCATATTACATGG - Intergenic
958922001 3:100117565-100117587 ATGCTCTTAATAACCATACGTGG - Intronic
959201444 3:103252757-103252779 ATGGTTTCAATGGTCATACATGG - Intergenic
959376908 3:105599260-105599282 ATTTATTTAATGTTCATACATGG + Intergenic
959428642 3:106224135-106224157 ATGGTTTTAATGAGAACACATGG + Intergenic
960124507 3:113983875-113983897 AAGCATTTAATAAACATACAGGG + Intronic
962419248 3:135213927-135213949 ATGCAATTCATGATAATACAGGG - Intronic
963227042 3:142872820-142872842 ATCCTTTTGATGATGATACTTGG - Intronic
964918475 3:161866141-161866163 AGACTTTTAATAATCATGCATGG - Intergenic
965342612 3:167508738-167508760 ATGCTTTCATTTGTCATACATGG + Intronic
965891084 3:173514161-173514183 ATGTTTTTAAAAGTCATACAGGG + Intronic
966055131 3:175677801-175677823 ATGAATTTAATGATTATAGATGG + Intronic
967414934 3:189205831-189205853 GTGCTAGTAATGATCACACATGG - Intronic
967753831 3:193145981-193146003 ATGCTATTAATGGTCACAAATGG - Intergenic
972085650 4:35210936-35210958 ATGCTTTTAAAGAATATCCAAGG - Intergenic
974720154 4:65727719-65727741 GTTCTTTTAATTATCATATACGG - Intergenic
977489017 4:97687877-97687899 ATTCTTTTATTGAACATCCATGG - Intronic
977868988 4:102066689-102066711 ATGCTTAAAAATATCATACAAGG + Intronic
978859822 4:113434961-113434983 ATAGTTTTAGTGATCTTACATGG - Intergenic
979650600 4:123125991-123126013 ATACTGTTAAGGAACATACAGGG + Intronic
980026156 4:127769750-127769772 ATGCTTAAAATGATCAGACGTGG + Intronic
980028991 4:127803389-127803411 ATTCTTTTAATTATGATATATGG + Intronic
980112722 4:128649874-128649896 AGTCTTTTAATGATCACCCAAGG - Intergenic
981209695 4:142088322-142088344 CTGCTTTTAATGTTGATAAATGG + Intronic
981330662 4:143504901-143504923 ATCCTTTTAATTTTCATTCATGG - Intergenic
981333777 4:143543553-143543575 ATGCTTCAAATGATTAGACATGG + Exonic
981799130 4:148635707-148635729 ATGCTGTTAAACATCCTACAAGG - Intergenic
982627627 4:157787260-157787282 ATATTTTTAATGACCAAACAGGG - Intergenic
983253286 4:165369245-165369267 ATGATTTTAATGATAATACTAGG - Intronic
983304791 4:165972381-165972403 ATTCTTTTCATGATGCTACATGG + Intronic
983870871 4:172823800-172823822 ATGATTTTAATTTTCATTCATGG - Intronic
984502346 4:180572084-180572106 ATGTTTTTAGTTATCTTACAAGG + Intergenic
985038581 4:185865889-185865911 TTTCTTTTAATGATAAAACAGGG + Intronic
986931647 5:12831980-12832002 ATGCTTCTAAAAATAATACAAGG + Intergenic
986947587 5:13043553-13043575 TTTCTTTTAATGATAATACATGG - Intergenic
987811938 5:22848255-22848277 ATGCTTTCAATGGACAGACATGG - Intronic
988185970 5:27862384-27862406 ATGTTTTTTATAATCATACTAGG - Intergenic
988463611 5:31465815-31465837 ATGCTTTTAATCATGGTAGAAGG - Intronic
988775956 5:34478203-34478225 ATGCTTTTACTCATCACAGAAGG - Intergenic
990257270 5:53983848-53983870 ATACTTTTAATGCTCCTCCAAGG + Intronic
993264547 5:85707284-85707306 CTGCTTTAAATGATGATCCAAGG + Intergenic
993658899 5:90606074-90606096 ATGCTTTTAATGATCATACAAGG - Intronic
993761755 5:91803978-91804000 AAGCTTTTATTGATCATGTATGG + Intergenic
996418438 5:123235632-123235654 GAGCTTTTAAAGACCATACATGG - Intergenic
999581788 5:153046975-153046997 ATGCTTTATAAAATCATACATGG - Intergenic
999819404 5:155210510-155210532 ATTTATTTAATGAACATACATGG - Intergenic
999951573 5:156657447-156657469 ATGTTTTTAATGAGAACACATGG - Intronic
1000142150 5:158415994-158416016 ATATTTTTAATGTTCATCCATGG - Intergenic
1000586845 5:163110879-163110901 ATGCTTTGAAGGATGATAAATGG - Intergenic
1004455715 6:15789752-15789774 ATGATTTTAATGTGCATCCATGG - Intergenic
1004567485 6:16812478-16812500 ATGCTTTTGAATATCATTCAAGG + Intergenic
1004828417 6:19449866-19449888 GTGCTTTTCATGATCATTAATGG + Intergenic
1005052106 6:21694517-21694539 GTGATTTGAATGATCATCCAAGG + Intergenic
1006976206 6:38104376-38104398 TTGCTTTTAATTATCAGATAAGG - Intronic
1007894030 6:45329660-45329682 TGGCTTTTAAAAATCATACAGGG - Intronic
1008851867 6:56032371-56032393 ATGCTCTTAATAGTCAAACATGG + Intergenic
1012007928 6:93739058-93739080 ATGCTGAAAATGATCACACAAGG + Intergenic
1014226363 6:118852480-118852502 AGGATTTTACTGATCATAAATGG + Intronic
1015957568 6:138614550-138614572 ATCCTTTCAATGACCCTACAAGG + Intronic
1016672952 6:146729892-146729914 ATGCTATTAAACATCCTACAGGG - Intronic
1016902747 6:149118266-149118288 AATCATTTAATAATCATACAGGG + Intergenic
1017353813 6:153478206-153478228 ATTCTTTTTGTGATCACACAGGG - Intergenic
1017969194 6:159296598-159296620 GTGCTTTTAATGATCATGCTGGG - Intergenic
1018675287 6:166216054-166216076 GTGTTTTAAATGATCATAAATGG - Intergenic
1019178585 6:170173690-170173712 ATCGTTTTAATGTTCACACATGG + Intergenic
1021221138 7:17976406-17976428 ATGCTTTTGATAATCAGCCAGGG - Intergenic
1021908070 7:25355369-25355391 ATGCTTTTAAAAATGATACAGGG - Intergenic
1022271526 7:28812392-28812414 TTGCTTTTACAGAACATACAAGG + Intronic
1031402143 7:121338186-121338208 ATTATTTTAATGAGCATCCAGGG - Intronic
1031451527 7:121926499-121926521 ATGCTTTTGAGGTTTATACATGG - Intronic
1034602241 7:152270769-152270791 ATTATTTTCATGATGATACAAGG - Intronic
1035016040 7:155766908-155766930 ATCCTTTTAATTGTCATAGAAGG + Intronic
1037718429 8:21419693-21419715 ATGTTTTTTATCATCATAAATGG + Intergenic
1038788266 8:30641964-30641986 ATGCTTTTAATAATTATGCTTGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041267647 8:56080844-56080866 ATGATTTTAATGAGCAAATAGGG - Intergenic
1042142670 8:65695315-65695337 ATCCTTATAATTATCCTACATGG - Intronic
1043140231 8:76579167-76579189 ATTCTCTTCATGATCACACAAGG + Intergenic
1043702678 8:83311433-83311455 ATTATTTTAATGATAATATATGG - Intergenic
1047023796 8:120805845-120805867 TAGCTTTTAATGCTCATAAATGG - Intronic
1048900781 8:139035555-139035577 ATGCTTTTGCTGATAAAACAAGG + Intergenic
1051565621 9:18494600-18494622 CTGCTTTTTGTAATCATACATGG - Intronic
1055678351 9:78689147-78689169 TTGCTTCTAATGATCAGAAATGG - Intergenic
1056012620 9:82347570-82347592 TTGCTTTTGACAATCATACAAGG - Intergenic
1056888810 9:90470089-90470111 ATCCTTTTAAAGATCCTCCATGG + Intergenic
1061392315 9:130324305-130324327 ATGTTTTTAAGGTTCATCCATGG + Intronic
1062714177 9:137997077-137997099 GTGCTTTCTCTGATCATACAGGG - Intronic
1185948927 X:4408576-4408598 ATGCATTTAATGTGTATACATGG + Intergenic
1186169401 X:6860862-6860884 ATGATTTTAATCATAATAGAAGG + Intergenic
1186612591 X:11152824-11152846 ATGATTTTAATGAGCAACCAGGG - Intronic
1186997856 X:15142799-15142821 GTGTTTTTAAAGATCTTACAAGG + Intergenic
1188566144 X:31528828-31528850 ATGCTAATAATAATCACACAGGG + Intronic
1189327864 X:40123934-40123956 ATGCTTTTAAGGATGCCACATGG + Intronic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1194244153 X:91491015-91491037 AAGCTGTAGATGATCATACAGGG + Intergenic
1194971547 X:100349391-100349413 GTGCTTTCACTGATAATACAAGG + Intronic
1199048454 X:143206185-143206207 AAGCTTTTAATCATAATGCAAGG + Intergenic
1199471660 X:148202461-148202483 ATGTTTTTATTTTTCATACATGG + Intergenic
1200563134 Y:4732333-4732355 AAGCTGTAGATGATCATACAGGG + Intergenic