ID: 993661660

View in Genome Browser
Species Human (GRCh38)
Location 5:90645151-90645173
Sequence TAGATGACCTTGCCTTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993661660_993661667 17 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG 0: 1
1: 0
2: 1
3: 13
4: 122
993661660_993661662 -8 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661662 5:90645166-90645188 GTCATCTATCAAGTGTCCTGTGG No data
993661660_993661666 16 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661666 5:90645190-90645212 GCAGTCTCAGCACCGGGACACGG 0: 1
1: 0
2: 0
3: 14
4: 135
993661660_993661665 10 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661665 5:90645184-90645206 TGTGGTGCAGTCTCAGCACCGGG 0: 1
1: 0
2: 0
3: 24
4: 320
993661660_993661668 18 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661668 5:90645192-90645214 AGTCTCAGCACCGGGACACGGGG 0: 1
1: 0
2: 0
3: 3
4: 100
993661660_993661664 9 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661664 5:90645183-90645205 CTGTGGTGCAGTCTCAGCACCGG 0: 1
1: 0
2: 1
3: 41
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993661660 Original CRISPR TAGATGACCTTGCCTTCAAA GGG (reversed) Intronic
904523781 1:31116365-31116387 TGGATGACAGTGCCTCCAAAGGG - Intergenic
904657932 1:32063209-32063231 TAGATGACCTGGCCTGCCATGGG + Intergenic
908029520 1:59984961-59984983 CAGATGACCTTTCCTGGAAAGGG - Intergenic
908795503 1:67827204-67827226 TACATGACCTTGCCTGCAAGGGG + Intronic
909423013 1:75487594-75487616 TAGAGTACCTTGCCCTCAGAGGG - Intronic
924121170 1:240799716-240799738 AAAATGTCCTTGCATTCAAAGGG + Intronic
1066669001 10:37817116-37817138 TAGATGCCACTGCCCTCAAATGG + Intronic
1071749657 10:88460416-88460438 TAAATGACATTGCCTCCAAGAGG + Intronic
1072780606 10:98248765-98248787 TTGGTGATCTTGCCATCAAAAGG + Exonic
1076662795 10:132066555-132066577 AAGATGACCTATTCTTCAAAAGG - Intergenic
1077659682 11:4056479-4056501 AAGCTGTCCTTGCCCTCAAAGGG + Intronic
1079859903 11:25656121-25656143 GAGATTACCTTGCCTAAAAAAGG - Intergenic
1080365758 11:31572101-31572123 TAGATGACACTGCCTTCTATTGG - Intronic
1080921641 11:36715118-36715140 TAGATCATCTTGCCTTCAGAGGG + Intergenic
1087894747 11:103575219-103575241 AAGATCACCTTCCCATCAAAGGG + Intergenic
1089204487 11:116748500-116748522 TGGAGGAACTTGCCTACAAATGG - Exonic
1092115087 12:5994997-5995019 AAAATGTCCTTGCATTCAAAGGG - Intronic
1094647735 12:32343172-32343194 TTGATGACCTTGACTCAAAAGGG + Intronic
1095410606 12:41917039-41917061 AAGGTGACTTTGACTTCAAAGGG - Intergenic
1100340683 12:93676924-93676946 TAAATGACCTTGCATTTTAATGG + Intergenic
1100405560 12:94270192-94270214 TAGATAACAGTACCTTCAAATGG - Intronic
1103294548 12:119875378-119875400 TAGCTGAACTTGCCTTAGAAGGG - Intronic
1103679091 12:122679157-122679179 TACATGACTGTGCCTTCAGATGG - Intergenic
1105669473 13:22596222-22596244 TTGATGAACTTCACTTCAAAAGG + Intergenic
1106250167 13:27976970-27976992 TAGAAGCTCTTGTCTTCAAAAGG + Intergenic
1111858454 13:93670514-93670536 TATATGACCTTTCCATCAATTGG - Intronic
1112618036 13:101025823-101025845 TAAATGACTTTTCTTTCAAAGGG - Intergenic
1113486981 13:110661234-110661256 TAGATGAAATTGCCTTCTATTGG - Intronic
1116759450 14:48993086-48993108 AAGATGACCTTGATTTAAAATGG - Intergenic
1116908393 14:50430466-50430488 TGTATGACTTTTCCTTCAAATGG + Intronic
1118138425 14:63052745-63052767 GAGATGTCATTGCCTTCAAGAGG + Intronic
1118865530 14:69700461-69700483 TAGAGGACCTTCCTTACAAAAGG - Intronic
1119049758 14:71355495-71355517 TAGATCACCTTGCCTGCAGTTGG + Intronic
1120035607 14:79693983-79694005 TAGCTAACCTTCCCTTCAAAAGG + Intronic
1120139131 14:80908026-80908048 TAGCTGACTCTGCTTTCAAAAGG - Intronic
1121494267 14:94381105-94381127 TCGGTGTCCTTGACTTCAAAGGG + Exonic
1121967064 14:98320059-98320081 GAGATGACCTTCACTGCAAATGG + Intergenic
1124111707 15:26796104-26796126 AACATGACCTTGCTTTGAAATGG - Intronic
1135841534 16:25881174-25881196 TAGATGAATTTGCCTACGAAGGG - Intronic
1140744742 16:77971583-77971605 TAGATGAACATTCCTTAAAAGGG - Intronic
1141064847 16:80906000-80906022 TATATGACCTTGACTTTCAATGG + Intergenic
1143751214 17:9029310-9029332 CAGATGTCCTGGCCATCAAAGGG + Intronic
1146543867 17:33721337-33721359 CAGATGGTCATGCCTTCAAATGG - Intronic
1152024676 17:77801238-77801260 AAGAGGACCTGGCCTTAAAATGG + Intergenic
1152404748 17:80090689-80090711 TAGATTTCATTGCCTTTAAAAGG + Intronic
1154072186 18:11162613-11162635 TGGAAGACCTTGCCTACAATGGG - Intergenic
1155272968 18:24158666-24158688 TAGATGGCCCAGCGTTCAAAAGG + Intronic
1155355077 18:24944123-24944145 TAGAGGACACTGCCTTCAAAGGG - Intergenic
1156668537 18:39438529-39438551 TAGGTGATCTTGCCCTCAGAGGG + Intergenic
1158298780 18:56029272-56029294 TTGAAGACTTTGGCTTCAAAAGG - Intergenic
1160097393 18:75887603-75887625 TATATCACCTTCCCTTCAAGAGG + Intergenic
925787148 2:7443248-7443270 TAAAAGACCTTGCTTTCAAGTGG + Intergenic
927343133 2:22005412-22005434 GAGAAGATCTTACCTTCAAAAGG - Intergenic
930966139 2:57329636-57329658 TAGATGAAATTACCTTCACAGGG - Intergenic
933849332 2:86352968-86352990 GGGATGACCTTGCCTTCAACAGG - Intergenic
934844125 2:97650965-97650987 CAGATCACCTTACTTTCAAATGG - Intergenic
935961288 2:108428137-108428159 TATATTACCTTACATTCAAAAGG - Intergenic
937006832 2:118524362-118524384 TTGATCACCTGGCCTTCATAAGG - Intergenic
937128112 2:119487426-119487448 TTAGTGACCTTGCCTTCAAGTGG - Intronic
938812983 2:134870760-134870782 TAGATGACTCTCCCTTCAAGTGG + Intronic
939016455 2:136909440-136909462 GAAATGGCCTTGCCTTCAAAGGG - Intronic
939150627 2:138468293-138468315 AAGATGGCATAGCCTTCAAAAGG - Intergenic
941198813 2:162483950-162483972 AAAATGGCCTTGCTTTCAAATGG + Intronic
945959300 2:216115412-216115434 AAGATTACCTTGCCTTAAGATGG + Intronic
947125568 2:226865082-226865104 TGGATGAACCTGACTTCAAAAGG + Exonic
1169873964 20:10275791-10275813 TAGAGGACCTTGACTTCTCAAGG - Intronic
1172432135 20:34900906-34900928 TAAATGACATGGCCTCCAAAAGG - Intronic
1174307011 20:49620272-49620294 AAGATGACCCTGCCCTCAAATGG - Intergenic
1174555288 20:51390947-51390969 GAGAACTCCTTGCCTTCAAAAGG + Exonic
1174871331 20:54185666-54185688 TATGTCACCTTGCCTTCAAAAGG + Intergenic
1182743429 22:32585695-32585717 TAGATGGTCCTGCCTTCAACAGG + Intronic
954545300 3:51429236-51429258 GAGAGGACCTTGCCTTGAAAGGG - Intronic
957863274 3:85988058-85988080 AAGATGACCTTGACTTCAGCTGG + Intronic
959587359 3:108037378-108037400 TAGAAAACCATGCCTTAAAATGG + Intergenic
959813783 3:110651653-110651675 TAAATGAATTTTCCTTCAAAAGG + Intergenic
960320409 3:116228056-116228078 TAGTAGACTTTGCCTTCTAATGG + Intronic
965114563 3:164471235-164471257 GAGATGATATTGGCTTCAAAGGG - Intergenic
968457992 4:708184-708206 TAGATGACCAGGACCTCAAACGG + Intronic
971794705 4:31212090-31212112 TAGTTGTGCATGCCTTCAAAAGG - Intergenic
972055296 4:34794735-34794757 AATATGTCCTTGCATTCAAAGGG - Intergenic
977096602 4:92753364-92753386 TAAATGACATTGTATTCAAAGGG + Intronic
977476944 4:97523455-97523477 TACATAGCCTTGCCTTGAAAGGG - Intronic
977889943 4:102297972-102297994 TAGAGGAACTGGCCTTAAAAAGG + Intronic
985370447 4:189280634-189280656 GAGATGTCCTTGCCTTAGAATGG - Intergenic
987218504 5:15765067-15765089 TAGATGACATTTCCCTTAAATGG + Intronic
987723926 5:21672498-21672520 TATATTACCTTACATTCAAAAGG + Intergenic
991547013 5:67793671-67793693 TACAAGGCCTTGGCTTCAAAAGG - Intergenic
991926265 5:71707952-71707974 TAAATGAACTAGGCTTCAAAGGG - Intergenic
992061922 5:73059671-73059693 CAGATTACCTTCCCTTCAAAAGG - Intronic
992228736 5:74642633-74642655 TAGATGACCTTGCCTAGAAATGG + Intronic
993661660 5:90645151-90645173 TAGATGACCTTGCCTTCAAAGGG - Intronic
994568767 5:101486028-101486050 TAGAGGAACTTGACATCAAAGGG + Intergenic
995490217 5:112683336-112683358 TATATGACATTGCCTGAAAAAGG + Intergenic
997342311 5:133154287-133154309 TAGACAACCTTGCCTGCAAAGGG - Intergenic
999118140 5:149183018-149183040 TGGCTGACCCTGCCTCCAAATGG - Intronic
1000859056 5:166434376-166434398 TAGATGACCTTGAATACAACTGG + Intergenic
1005730796 6:28694833-28694855 TACATGAACTAGCATTCAAAAGG + Intergenic
1006299729 6:33187219-33187241 TAGATGCCTTGGCCTTCCAATGG + Intronic
1009334606 6:62471374-62471396 TAGATGCCCTTCTCTTGAAAGGG + Intergenic
1013158020 6:107512336-107512358 AAGATGATCATGCCTTTAAAGGG + Intronic
1016152119 6:140754267-140754289 TGAATGACTTTGGCTTCAAAAGG + Intergenic
1016511759 6:144850443-144850465 TGTTTGACCTTCCCTTCAAAAGG + Intronic
1017239597 6:152152289-152152311 TAGATGACTTTGCATTAACAAGG - Intronic
1018342826 6:162869303-162869325 TAGAATACCTTGTCTGCAAAAGG + Intronic
1020704133 7:11521726-11521748 TGTATGACGTTTCCTTCAAATGG + Intronic
1024194813 7:47048536-47048558 TTGGTGACCTTGCCCTCACATGG - Intergenic
1027703118 7:81493860-81493882 TTGATGACCATTCCTTCAAATGG - Intergenic
1028204151 7:87997001-87997023 CAGATGCCCTTTCCTTTAAAGGG + Intronic
1029126330 7:98297339-98297361 TAGTTGACCTGGCTTTCAGAGGG + Intronic
1031820596 7:126496640-126496662 TGGATGATTTTACCTTCAAAGGG - Intronic
1037089066 8:14890700-14890722 TAGATGAAATTGCCTTCCATTGG + Intronic
1038737556 8:30186050-30186072 TTGATGCTATTGCCTTCAAAAGG - Intergenic
1039400566 8:37265670-37265692 AAGAAGACCCTGACTTCAAATGG + Intergenic
1040058384 8:43082507-43082529 TAGCTGATGTTTCCTTCAAAAGG + Intronic
1040923150 8:52647209-52647231 CAGATAACCTTTCCTCCAAAGGG + Intronic
1043113022 8:76212172-76212194 TAGAAGGCCTTGCCTTAAAAAGG - Intergenic
1044493182 8:92844977-92844999 GAGATGACATTGCTTTCTAATGG + Intergenic
1045581358 8:103483883-103483905 TAACTGACCTTGCCTACAAAAGG - Intergenic
1045730897 8:105239626-105239648 TAGATTTCCTGGCCTTAAAATGG - Intronic
1046997642 8:120542297-120542319 TAGGTGTACTTGCCTTCCAATGG + Intronic
1058872908 9:109217941-109217963 GAGATGACACGGCCTTCAAATGG - Intronic
1062073095 9:134569542-134569564 TAGGTCACCTTGGCTTCAAGAGG - Intergenic
1186421552 X:9430844-9430866 TAAATGACTTTGCCTGGAAAAGG - Intergenic
1192223654 X:69214185-69214207 TAAATGAGCTTGACTTCACAGGG - Intergenic
1193530672 X:82650531-82650553 TGGAAAACCCTGCCTTCAAAAGG - Intergenic
1198523498 X:137475682-137475704 TAAATGACCATGGTTTCAAATGG - Intergenic
1199289727 X:146092397-146092419 TAGATGAAACTGCCTTCAATTGG - Intergenic
1199952322 X:152715968-152715990 TTGATGACCTTGTTTTCAGAAGG + Exonic
1199957361 X:152752480-152752502 TTGATGACCTTGTTTTCAGAAGG - Exonic
1199976112 X:152895850-152895872 CAGCTGATCTTGCCTGCAAACGG - Intergenic
1200856407 Y:7943234-7943256 TCTTTGGCCTTGCCTTCAAAGGG - Intergenic