ID: 993661661

View in Genome Browser
Species Human (GRCh38)
Location 5:90645152-90645174
Sequence ATAGATGACCTTGCCTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993661661_993661667 16 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG 0: 1
1: 0
2: 1
3: 13
4: 122
993661661_993661666 15 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661666 5:90645190-90645212 GCAGTCTCAGCACCGGGACACGG 0: 1
1: 0
2: 0
3: 14
4: 135
993661661_993661668 17 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661668 5:90645192-90645214 AGTCTCAGCACCGGGACACGGGG 0: 1
1: 0
2: 0
3: 3
4: 100
993661661_993661662 -9 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661662 5:90645166-90645188 GTCATCTATCAAGTGTCCTGTGG No data
993661661_993661664 8 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661664 5:90645183-90645205 CTGTGGTGCAGTCTCAGCACCGG 0: 1
1: 0
2: 1
3: 41
4: 263
993661661_993661665 9 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661665 5:90645184-90645206 TGTGGTGCAGTCTCAGCACCGGG 0: 1
1: 0
2: 0
3: 24
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993661661 Original CRISPR ATAGATGACCTTGCCTTCAA AGG (reversed) Intronic
901077385 1:6563822-6563844 ATAGATGACCTCCCCTTTCAAGG - Intronic
902278103 1:15354057-15354079 ATAGGTGACTATGACTTCAAAGG + Intronic
904343041 1:29850334-29850356 AAAGAGGACTTTGCCTTTAAAGG + Intergenic
904399860 1:30248960-30248982 ATAGATGACATTGCTCTCAGAGG + Intergenic
904657931 1:32063208-32063230 CTAGATGACCTGGCCTGCCATGG + Intergenic
904793284 1:33039803-33039825 TTAGATGAACTTGCCTTGAAGGG - Intronic
906787694 1:48630254-48630276 AGTGATGACATTGACTTCAAAGG - Intronic
907929632 1:58987395-58987417 ATAGAGTCCCTTGTCTTCAATGG + Intergenic
908795502 1:67827203-67827225 TTACATGACCTTGCCTGCAAGGG + Intronic
910006582 1:82404440-82404462 ACCAATGAGCTTGCCTTCAAGGG + Intergenic
911204825 1:95081535-95081557 ATAGTTGCCTTAGCCTTCAAGGG - Intergenic
913487007 1:119340940-119340962 ATAGATAAACTTGCCTTATAGGG - Intergenic
918302249 1:183215043-183215065 AAAGATGACTTTGCCTGCCAGGG + Intronic
919361649 1:196603751-196603773 ATAAATGACCTTCTCTTCTATGG + Intronic
921691075 1:218151350-218151372 TTAGATGACCTCTCCGTCAATGG + Intergenic
922221868 1:223614539-223614561 AAAGATGAACTTGATTTCAAGGG - Intronic
923412887 1:233727267-233727289 ATGGCTGGCCTTGGCTTCAAAGG - Intergenic
924121169 1:240799715-240799737 AAAAATGTCCTTGCATTCAAAGG + Intronic
1063403569 10:5771371-5771393 AAAAATGTCCTTGCATTCAAGGG - Intronic
1064424013 10:15214173-15214195 ATAGATTTTCTTGCCTTTAAGGG + Exonic
1066262334 10:33741248-33741270 ATAGTTTACCTTTCCATCAATGG - Intergenic
1069099620 10:64303541-64303563 AGAGAAGACCTAGCGTTCAAGGG + Intergenic
1069940359 10:71951285-71951307 ATAGATGACGTTCTCTTCCAAGG - Intergenic
1071095302 10:81967165-81967187 ATAGATGATATTGTATTCAAAGG - Intronic
1074278405 10:112026788-112026810 ATACATGACTTTACCTTCCAGGG - Intergenic
1078024931 11:7685747-7685769 AGATGTGCCCTTGCCTTCAAGGG - Intergenic
1079447445 11:20569896-20569918 TTAATTAACCTTGCCTTCAAGGG + Intergenic
1080921640 11:36715117-36715139 ATAGATCATCTTGCCTTCAGAGG + Intergenic
1083115326 11:60453752-60453774 AAAACTGACCCTGCCTTCAAGGG + Intronic
1085999814 11:81969241-81969263 TTAGATTACCTTGCCATCTAAGG + Intergenic
1086048627 11:82562939-82562961 AAACATGACCCTACCTTCAATGG + Intergenic
1086164608 11:83763036-83763058 ATAGGGAACTTTGCCTTCAAGGG - Intronic
1086355662 11:85996663-85996685 ATAAATGAACATACCTTCAAGGG + Intronic
1087894746 11:103575218-103575240 AAAGATCACCTTCCCATCAAAGG + Intergenic
1088305216 11:108400397-108400419 ATTGATGACCTTACCTTGATTGG - Intronic
1091629930 12:2152395-2152417 AGGCATGACTTTGCCTTCAAGGG - Intronic
1092115088 12:5994998-5995020 AAAAATGTCCTTGCATTCAAAGG - Intronic
1094774692 12:33711660-33711682 ATAGATTAGCTTGTGTTCAATGG + Intergenic
1095410607 12:41917040-41917062 AAAGGTGACTTTGACTTCAAAGG - Intergenic
1097328095 12:58302089-58302111 TTAGATGAACTTGCCTTGTAGGG + Intergenic
1098456543 12:70681000-70681022 ATATAGCACCTTGCCCTCAAAGG - Intronic
1103294549 12:119875379-119875401 ATAGCTGAACTTGCCTTAGAAGG - Intronic
1105787129 13:23760336-23760358 ATAGGTGACGTAGCCTTCTAGGG - Intronic
1105981128 13:25517557-25517579 ATTTATGAACTTACCTTCAAAGG + Intronic
1107554981 13:41509799-41509821 AGAGATGACATGGCCTTCAATGG + Intergenic
1110872894 13:80473119-80473141 ATAAAAGACCTTGCCTGAAATGG - Intergenic
1111252571 13:85622264-85622286 ATAAAATACCTTGCCTTCAATGG - Intergenic
1111990821 13:95115373-95115395 TTAGATATCCTTGCCTTTAAAGG + Intronic
1113047320 13:106169924-106169946 AGAGATGGCCATGCCCTCAAAGG + Intergenic
1117384839 14:55201199-55201221 TTAGATGACCTTGCCCTGTAGGG - Intergenic
1117992473 14:61448321-61448343 ATAGTTGAGCTTGTCATCAAAGG - Intronic
1118031308 14:61820870-61820892 ATAAATGACCTTGTCTCCACTGG + Intergenic
1119917637 14:78417087-78417109 ATAGTTGACCTTGCATTTCAGGG - Intronic
1120945136 14:89987745-89987767 ATAGATGAACTTGCCCTGTAGGG + Intronic
1121146540 14:91588330-91588352 ATATCTCACATTGCCTTCAAGGG + Intronic
1124835400 15:33192120-33192142 TTAGATGATCTTGCCTTTAATGG - Intronic
1124950192 15:34311198-34311220 ATTGATAAACTTGCCTTCACTGG - Intronic
1125117912 15:36117344-36117366 ATATAAGATCTTTCCTTCAAGGG - Intergenic
1126189767 15:45867263-45867285 ATACATCACCTAGCCTACAATGG - Intergenic
1126194394 15:45916061-45916083 AGGGATGATATTGCCTTCAAGGG - Intergenic
1129885539 15:79034581-79034603 ATAAATGACAGTGCCTTCATGGG + Intronic
1132229827 15:100173285-100173307 ATAGATGAACTTGCCCTGTAGGG - Intronic
1137764396 16:50966939-50966961 AGAGCTGGCCCTGCCTTCAAGGG - Intergenic
1139104875 16:63816715-63816737 ATAGATGTTCCTGTCTTCAAAGG - Intergenic
1141403281 16:83769786-83769808 GTAGATGACCTTGCCTTGTAGGG + Intronic
1143751213 17:9029309-9029331 ACAGATGTCCTGGCCATCAAAGG + Intronic
1154072187 18:11162614-11162636 GTGGAAGACCTTGCCTACAATGG - Intergenic
1154249555 18:12732417-12732439 ATATATGACCTTGACTACCAAGG - Intergenic
1155355078 18:24944124-24944146 TTAGAGGACACTGCCTTCAAAGG - Intergenic
1156440550 18:37183017-37183039 ATGAATGACCCTGCATTCAAAGG + Intronic
1160053926 18:75462082-75462104 ATAGATGCCCTTGGCTCCACTGG + Intergenic
1160231680 18:77053857-77053879 ACAGATGTCCCTGCCTTCATGGG + Intronic
925708549 2:6715133-6715155 ATCGATGTGTTTGCCTTCAAAGG - Intergenic
925818101 2:7773128-7773150 ATTCATGACCTTGCTTTAAAAGG + Intergenic
931485024 2:62682059-62682081 AAAAATGAGTTTGCCTTCAATGG + Intronic
933945227 2:87280344-87280366 ATAGAAGACTTAGCCTTAAAGGG + Intergenic
934541756 2:95181170-95181192 ACAGAGGACTTTGCCTTCCAAGG - Exonic
936334980 2:111581247-111581269 ATAGAAGACTTAGCCTTAAAGGG - Intergenic
939016456 2:136909441-136909463 AGAAATGGCCTTGCCTTCAAAGG - Intronic
940460907 2:153961346-153961368 ATATTAGACCTTGCCTTCAAAGG - Intronic
945655941 2:212624217-212624239 ACAGCTGACATTGCATTCAATGG + Intergenic
946908423 2:224437778-224437800 ATAGATGTCCTACCCTTCATAGG - Intergenic
948341345 2:237254845-237254867 AAAGATTACCTTTCATTCAAGGG - Intergenic
948604684 2:239127364-239127386 ATAGATGATCTTGCTTTAATTGG + Intronic
1169469581 20:5872130-5872152 GTAGATGACCTGGCCTGCATGGG - Intergenic
1173050080 20:39550797-39550819 ATAGTTCACCTTGCTTTGAATGG + Intergenic
1173125544 20:40332943-40332965 AGACCTGACCTTTCCTTCAAAGG - Intergenic
1174163404 20:48567599-48567621 AAAGAAGGCCTTTCCTTCAAAGG - Intergenic
949344709 3:3066080-3066102 ATAGTGGACTTTGCCTTAAAAGG + Intergenic
951811921 3:26709979-26710001 ATCGATGAGCATGCCTTCAAAGG + Exonic
954545301 3:51429237-51429259 TGAGAGGACCTTGCCTTGAAAGG - Intronic
960087665 3:113608189-113608211 AAAGATGTCCTTGGCTTCCAGGG - Exonic
960189586 3:114687113-114687135 ATAGAGGACATAGCCTACAAAGG + Intronic
961035245 3:123637555-123637577 ATTGATGATCGAGCCTTCAATGG - Intronic
961930910 3:130531698-130531720 ATGGCTGCCCCTGCCTTCAAGGG - Intergenic
966475035 3:180335055-180335077 GTAGAAGCCCTTACCTTCAAGGG - Intergenic
967293156 3:187941316-187941338 CTAGATGAACTTGCTTTCACAGG - Intergenic
970278689 4:14429930-14429952 AAAGATCACCTTGGCTTTAAGGG + Intergenic
971229066 4:24783373-24783395 TTGGATGACCTTGCCTAGAAAGG + Intergenic
971692437 4:29854321-29854343 ATAGCTGACCTTGACTTGGAGGG - Intergenic
972055297 4:34794736-34794758 AAATATGTCCTTGCATTCAAAGG - Intergenic
973904280 4:55511073-55511095 ATAGCTGACCTTGCCATGGATGG + Intronic
973907002 4:55542439-55542461 ATAATTGACCCTGCCTTCAGTGG - Intronic
977096601 4:92753363-92753385 ATAAATGACATTGTATTCAAAGG + Intronic
977471103 4:97444409-97444431 ATAAAAGACATTACCTTCAAAGG + Intronic
977920279 4:102635553-102635575 ATAAATAACCTTGCATTTAAGGG + Intronic
979103280 4:116650627-116650649 AAATATGGCATTGCCTTCAAGGG - Intergenic
980277806 4:130677836-130677858 ATAGATGAACTTGCCTTGTAGGG - Intergenic
983211349 4:164961334-164961356 AGAGATGAAGATGCCTTCAATGG + Intronic
985797358 5:1972865-1972887 AAGCATGACATTGCCTTCAAGGG + Intergenic
986626943 5:9731233-9731255 ATAGATGACGTTGCTTTGAGTGG - Intergenic
987569355 5:19635506-19635528 AAAGATGACTTTGTCATCAAGGG - Intronic
989212605 5:38870969-38870991 ACAGATGAACTTGCCTTGTAGGG + Intronic
991062033 5:62386659-62386681 AGAGTTGACTTTGCCTTAAAAGG + Intronic
993661661 5:90645152-90645174 ATAGATGACCTTGCCTTCAAAGG - Intronic
997342312 5:133154288-133154310 TTAGACAACCTTGCCTGCAAAGG - Intergenic
1000579126 5:163013427-163013449 AAAGATAACCTTTCCCTCAAGGG - Intergenic
1000833479 5:166130301-166130323 ATAAATGACCTTCTCTTCCAAGG - Intergenic
1004760896 6:18664785-18664807 AGAGATGACCTTGCCTAAATGGG - Intergenic
1012009207 6:93759036-93759058 CAAAATGACCTAGCCTTCAATGG + Intergenic
1013856170 6:114575017-114575039 ATAGATGACTCTTCCCTCAAAGG + Intergenic
1016784938 6:148000755-148000777 AAAGATGACCTTGGTTTCAAGGG - Intergenic
1023198195 7:37665012-37665034 AGAGATGAGCTTGCCTTCTAGGG + Intergenic
1023403132 7:39805177-39805199 AGCAATGTCCTTGCCTTCAAAGG - Intergenic
1023563205 7:41496994-41497016 AGGCATGACCTTGTCTTCAAGGG + Intergenic
1024646201 7:51372959-51372981 AGCAATGTCCTTGCCTTCAAAGG + Intergenic
1028204150 7:87997000-87997022 ACAGATGCCCTTTCCTTTAAAGG + Intronic
1030150455 7:106399227-106399249 AAAGATCAACTTGCCTTGAATGG + Intergenic
1030743914 7:113141789-113141811 ATACATGACCTTTCCTTTCAGGG + Intergenic
1030968267 7:116021257-116021279 AAAGTCGACCTTGCCTTTAATGG - Intronic
1032861543 7:135884576-135884598 CTAGCTGACCTTGCCTTAGATGG - Intergenic
1038256165 8:25953268-25953290 ATTGATCACCATGTCTTCAATGG + Intronic
1038476488 8:27872031-27872053 ATGGATGACGTTGCCTGCAAGGG - Exonic
1041726450 8:61022019-61022041 ATAGAAGACTTTGACTTAAAGGG - Intergenic
1042858264 8:73288887-73288909 ATAAATGTCATTGCTTTCAAGGG - Intergenic
1044701716 8:94971279-94971301 AAAGATGGCCTTGACTCCAAAGG + Intronic
1050173965 9:2851029-2851051 TTAGAAGTCCTTGTCTTCAAAGG - Intergenic
1052138964 9:24954163-24954185 ATAAATGAACTTTTCTTCAAGGG - Intergenic
1055507150 9:76959868-76959890 ATAAATGCCCTAGCGTTCAATGG - Intergenic
1059365887 9:113786113-113786135 AAGGGTGACCTTGCCTTCAATGG - Intergenic
1062611458 9:137376411-137376433 ATAGATGAGCTTGCCCTGTAGGG - Intronic
1185826455 X:3255839-3255861 ATGTATGACCTTCCCTTTAATGG + Intergenic
1187888298 X:23909342-23909364 ATTGATGACTTTGTCATCAATGG + Intronic
1191779288 X:64848842-64848864 ATAGATGATCTTCTCTTCCAAGG + Intergenic
1192271136 X:69580751-69580773 AAAGATAACCTTTCCTTCTAGGG + Intergenic
1192916828 X:75660700-75660722 ATAGATGAACTTGCCCTGGAGGG - Intergenic
1197649668 X:129051014-129051036 ATGGATGGCCTTGTCTTCACTGG - Intergenic