ID: 993661667

View in Genome Browser
Species Human (GRCh38)
Location 5:90645191-90645213
Sequence CAGTCTCAGCACCGGGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993661661_993661667 16 Left 993661661 5:90645152-90645174 CCTTTGAAGGCAAGGTCATCTAT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG 0: 1
1: 0
2: 1
3: 13
4: 122
993661660_993661667 17 Left 993661660 5:90645151-90645173 CCCTTTGAAGGCAAGGTCATCTA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993661667 Original CRISPR CAGTCTCAGCACCGGGACAC GGG Intronic
900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG + Intergenic
902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG + Intergenic
902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG + Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
908703899 1:66930302-66930324 GAGACTCAGCAACGGGACTCCGG - Intronic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
921166548 1:212512144-212512166 GAGGCTCACCAACGGGACACAGG - Intergenic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1076792467 10:132784680-132784702 CAGCCTCCGCACCGGGAACCCGG + Intergenic
1077433249 11:2526409-2526431 CAGTCCCAGCAGCGGGACTATGG + Intronic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG + Intronic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1091154599 11:133361525-133361547 CTGTCTGCGCGCCGGGACACGGG - Intronic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1102569568 12:113819225-113819247 CACTCTGAACACCGGGTCACAGG + Intronic
1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG + Intronic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG + Intergenic
1110370088 13:74730000-74730022 CAGTCTCTACACCGATACACAGG + Intergenic
1113657369 13:112075855-112075877 CATCCTCAGCACCTGGACACAGG - Intergenic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1122115972 14:99527436-99527458 CAGTCTCAGGACGGGGAGAAGGG + Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130828295 15:87572490-87572512 CAGCCTCTGCTACGGGACACTGG + Intergenic
1132540769 16:508220-508242 CAGTCACAGCACCGGGTCAGAGG - Intronic
1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG + Intronic
1134179678 16:12037385-12037407 CAGTCTCAGCCCTGGACCACAGG - Intronic
1135306423 16:21371154-21371176 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1136269328 16:29139243-29139265 CAGGCTCAGCAAGGGGGCACTGG - Intergenic
1136303166 16:29350298-29350320 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1140757624 16:78082463-78082485 CAATGACAGCACCTGGACACAGG + Intergenic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1141882017 16:86866526-86866548 AAGTCTCAGCTCCTGCACACCGG - Intergenic
1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG + Intergenic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1152465784 17:80465439-80465461 GAGTCTGGGCAGCGGGACACGGG - Intergenic
1160579947 18:79877971-79877993 CAGTCTCAGGACGTGGCCACAGG - Intronic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
1202647878 1_KI270706v1_random:158078-158100 CAGTCCCTGCACTGGGACCCAGG + Intergenic
925845122 2:8027828-8027850 CAATCTCAGCACGGGAGCACTGG - Intergenic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
930066601 2:47332521-47332543 CAGTCTCAGCACCTGGCTAGGGG + Intergenic
935815205 2:106841081-106841103 TAATGTCAGCACAGGGACACAGG + Intronic
937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG + Intergenic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
946396852 2:219447718-219447740 CAGACTCAGCCCCAGGACTCGGG - Intronic
947137168 2:226987053-226987075 CATTCTCAGCACAGTAACACAGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG + Intronic
1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG + Intronic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176603973 21:8814651-8814673 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179716431 21:43291082-43291104 CAGTGTCAGCACCCGGGCACGGG - Intergenic
1179809564 21:43861830-43861852 CAATCTGAGCACCTGCACACTGG + Intergenic
1180346257 22:11706228-11706250 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1181523040 22:23460232-23460254 CAGTCTGAGGACCTGGACAGGGG - Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1184384250 22:44165341-44165363 CATTCTCAGCACCGGCATGCAGG - Intronic
1185324553 22:50219361-50219383 CAGTCTCATCAGCGGCAGACTGG + Exonic
949724532 3:7028129-7028151 CAGGCTAAGCACTGGGAAACTGG - Intronic
950713636 3:14831964-14831986 CACTCTGAGAACCGTGACACTGG - Intronic
953699325 3:45183841-45183863 CAGTCTCAGCAAGGTGACATAGG + Intergenic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
968257653 3:197292002-197292024 CAGTCTCACCAGCAGCACACAGG - Intronic
973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG + Intergenic
973383269 4:49333974-49333996 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973386877 4:49518989-49519011 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
983961380 4:173759282-173759304 CATTCTCAGAACTGGGAGACAGG + Intergenic
986135630 5:4974999-4975021 GAGTCCCAGCACCTGGGCACAGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
997808281 5:136941534-136941556 CAGTCTCAGCAAACTGACACAGG - Intergenic
1001529995 5:172454694-172454716 GCGGCTCAGCACCGGGACAAAGG - Intergenic
1002685467 5:181005855-181005877 CTGTCTCATCCCCAGGACACTGG - Exonic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019142621 6:169957705-169957727 CTGGCGCAGCACCTGGACACGGG + Intergenic
1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG + Intergenic
1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG + Intronic
1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG + Intronic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG + Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1045402613 8:101834278-101834300 CAGCCCCAGCAGGGGGACACCGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG + Intergenic
1053762712 9:41357278-41357300 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1054541315 9:66268392-66268414 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG + Intergenic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1059615312 9:115944464-115944486 AAGTATCAGCAGCTGGACACTGG - Intergenic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1061200779 9:129137351-129137373 CAGTTTCCTCACCTGGACACTGG - Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1203551385 Un_KI270743v1:166810-166832 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1190657035 X:52621724-52621746 CAGTCTCAACATCTGCACACTGG + Intergenic
1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG + Intronic
1192398538 X:70810519-70810541 CATTCTCAGCAACCTGACACAGG + Intronic
1199911289 X:152289710-152289732 CAGTGAAAGCACCTGGACACAGG - Intronic
1200884637 Y:8254908-8254930 CAGTCTCTGCACCTTGAAACAGG - Intergenic