ID: 993661863

View in Genome Browser
Species Human (GRCh38)
Location 5:90647433-90647455
Sequence TGTGATCTGAAAATATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993661863 Original CRISPR TGTGATCTGAAAATATGTGA TGG Intronic
903406342 1:23099960-23099982 TGGGATCTGAAGAAATGAGAAGG - Intronic
905148569 1:35907743-35907765 GGGGATCTGAATATATTTGAGGG - Intronic
905491295 1:38346058-38346080 TGTGATCTGAGCAGATGTCAGGG - Intergenic
905605476 1:39295154-39295176 TGTGACTTGAGAATGTGTGAAGG + Intronic
907259705 1:53208439-53208461 TTTTATCAGAAAATATGTCAGGG - Intronic
907701889 1:56796873-56796895 TGTCATCTCAAAATATTTGTTGG + Intronic
908033164 1:60023014-60023036 TATGATCTGAAAATATTAAATGG - Intronic
910123561 1:83816528-83816550 TGTAATCTTCAAATATGTCAAGG - Intergenic
910269324 1:85376359-85376381 TATTAACTGAAAATATGTAATGG + Intronic
911028337 1:93458746-93458768 TGTGGTCTGAAAATATTAAATGG + Intronic
911540780 1:99155690-99155712 TGTGTTATGAAAACATTTGAGGG - Intergenic
914221388 1:145685150-145685172 TGTGGTCTGAAAATATTAAATGG - Intronic
914473954 1:148008017-148008039 TGTGGTCTGAAAATATTAAATGG - Intergenic
914981628 1:152419621-152419643 GTTGATCTGAAAATATATTATGG - Intergenic
915708142 1:157866694-157866716 TGTAGGCTGAAAATATGTGGAGG - Intronic
916089480 1:161296288-161296310 TGTGGTCTGAAAATATTAAATGG + Intergenic
917464727 1:175266076-175266098 TATGATCTGAAAATATTAAATGG - Intergenic
918504872 1:185242625-185242647 TGTGATTTGATAATTTATGATGG - Intronic
918895180 1:190334039-190334061 TGTGAGGTGAAAATGTGGGAAGG - Intronic
919337219 1:196251440-196251462 TGTAATTTGAAACAATGTGATGG + Intronic
919545482 1:198912312-198912334 TGTAATCTTAAAATATCTTATGG - Intergenic
919563188 1:199149591-199149613 TCTGAGAGGAAAATATGTGAGGG - Intergenic
919777556 1:201204184-201204206 TCTGATCTGAAAATAATTGATGG - Intronic
919953172 1:202385636-202385658 TTTGATCTGTAAAAATGAGAGGG - Intronic
920704289 1:208240525-208240547 TTTGAACTGAGCATATGTGAAGG + Intronic
921400790 1:214721495-214721517 TGTTCTCTAAAAATGTGTGATGG - Intergenic
921542034 1:216428165-216428187 TGTGCTTTAAATATATGTGAAGG + Intergenic
921603112 1:217127985-217128007 TGTCACCTGAAAACATCTGAGGG - Intronic
923249132 1:232163160-232163182 TGAGTTCTCAAAATATCTGATGG - Intergenic
923649631 1:235862344-235862366 TGTGGTCTGAAAATATTAAATGG + Intronic
1064078759 10:12291273-12291295 AGTGATATGAAAATATGGGCTGG - Intergenic
1064804111 10:19111144-19111166 TGTCTTCTGAATATATATGATGG - Intronic
1065938480 10:30542862-30542884 TGTGATTTCAAAATATGGAAGGG - Intergenic
1066601996 10:37119670-37119692 TGTGAGCTGAAAATAATTCAAGG - Intergenic
1068145444 10:53063855-53063877 TTTAATCTGAAAATAGGTGCTGG - Intergenic
1069245370 10:66198322-66198344 TGTCATCTGAAACTATCGGAAGG + Intronic
1071130884 10:82392150-82392172 TGTGAACTGAGAATAAGAGATGG + Intronic
1071332497 10:84573893-84573915 TGTGATATGATAAGATGGGAAGG - Intergenic
1073807408 10:107113147-107113169 TGTGGTCAGAAAATATATGTGGG - Intronic
1073861517 10:107748118-107748140 TGTAAAATGAAAATATGAGAAGG + Intergenic
1073913549 10:108375751-108375773 TGTGGTCTGAAAATATTAAATGG + Intergenic
1073974977 10:109090225-109090247 TGTAATCTGAAATTTTGGGATGG - Intergenic
1074166536 10:110882549-110882571 TTTGACCTTAAAATATTTGATGG + Intronic
1074666696 10:115735822-115735844 TGTGGTCTGAAAATATTAAATGG - Intronic
1074696594 10:116055400-116055422 AGTGATGTGAAAATATGAGCAGG - Intergenic
1075823375 10:125333113-125333135 TATGTTCTGAAAATATGTGGTGG + Intergenic
1076054618 10:127361745-127361767 TGTGTTCTGAATCTGTGTGATGG + Intronic
1077893239 11:6434748-6434770 TGTGGTCTGAAAATATGGACTGG + Intronic
1077925342 11:6676708-6676730 TCTGATTTGAAAATAGGTAAAGG + Intergenic
1078902640 11:15655752-15655774 TGTGGTCTGAAAATATTAAATGG - Intergenic
1079930047 11:26547100-26547122 TGTGATGTGAAAAAATGAAAAGG + Intronic
1080580176 11:33635925-33635947 TATGATCTGAAAATATTAAATGG + Intronic
1082032451 11:47615298-47615320 TCTGATTTGAAAATCTGTGGGGG - Intergenic
1084841898 11:71859384-71859406 TCTGATGTGAAATTATGTGATGG + Intergenic
1085860532 11:80228329-80228351 TATGATAAGAAAATATCTGATGG + Intergenic
1085942713 11:81224485-81224507 TGTGATCTGAAAATATTAAATGG + Intergenic
1086920212 11:92578103-92578125 TGTGTTTAGAAAATATGTGCAGG + Intronic
1087818494 11:102685331-102685353 GGTGACCTAAAAATATGTCATGG - Intergenic
1087834583 11:102859925-102859947 TGTGTTTTTAAAATATGAGAGGG - Intergenic
1088356336 11:108947908-108947930 TGTGGTCTGAAAATATTAAATGG + Intergenic
1089161767 11:116443613-116443635 TGAGATCTGAAAATATTAAATGG + Intergenic
1089545144 11:119218478-119218500 TGTGGTCTGAAAATATTAAATGG + Intronic
1090454903 11:126840576-126840598 TGTGGACTGAAAATATATGTGGG + Intronic
1090562050 11:127942984-127943006 TGTGGTCTGAAACTAGGTGGAGG - Intergenic
1091395002 12:148883-148905 TGGGAGCTGAAAATAGGTAATGG - Intronic
1091512207 12:1139123-1139145 TGTGGTCTGAAAATATTAAATGG + Intronic
1091578311 12:1760760-1760782 TGAGATCTGAAAATATTAAATGG + Intronic
1091868882 12:3870092-3870114 TGCGGTCTGAAAATATGAAATGG - Intronic
1092450779 12:8600215-8600237 TGGGATCTGAAACTATGTCCAGG - Intergenic
1093806116 12:23435171-23435193 TGTACTCTGAAAATGAGTGATGG - Intergenic
1094266069 12:28561553-28561575 TGTGATACTAAAAAATGTGATGG - Intronic
1094405643 12:30113227-30113249 TGTCTTCTAACAATATGTGAAGG + Intergenic
1095327877 12:40919848-40919870 TTTGTTCTCAAAATATTTGATGG + Intronic
1095563261 12:43590543-43590565 TGTGCTCTGCAAATTTGTGTTGG + Intergenic
1095567034 12:43636596-43636618 TGTGATCAGAGACTATTTGATGG - Intergenic
1098434760 12:70456972-70456994 TATGAACTGTAAATGTGTGAAGG + Intergenic
1098612223 12:72472924-72472946 TGTGATCTTAAAATGTGTTGTGG - Intronic
1099631903 12:85160231-85160253 TGTTATCTGAAAATACATTAGGG + Intronic
1100514087 12:95309229-95309251 TGTGATATGAGACCATGTGATGG - Intergenic
1100588436 12:96000713-96000735 TATGATCACAAAATATGTCAAGG - Intergenic
1101486584 12:105169554-105169576 TGTGGTCTGAAAATATTACATGG + Intergenic
1102366533 12:112341334-112341356 TCTGATCTTAAAAAAGGTGAAGG - Intronic
1106389828 13:29324232-29324254 TGTCTTCTGAAAATTTGTTATGG + Intronic
1107108343 13:36670709-36670731 TGTGATCTGAAAATATTCAATGG + Intergenic
1107789278 13:43984935-43984957 TTTGTCTTGAAAATATGTGATGG + Intergenic
1107967623 13:45611965-45611987 AGTGAGCTGCAAATATTTGAAGG + Intronic
1109661978 13:65472272-65472294 TGTTATTTGCAAATATGAGAAGG - Intergenic
1109876668 13:68414483-68414505 TATAATCTTCAAATATGTGAAGG - Intergenic
1109998608 13:70164574-70164596 TGTCATCTGAGCATAAGTGAAGG + Intergenic
1110306899 13:73998796-73998818 TGGGAACTAAAAATATTTGAAGG + Intronic
1110535167 13:76642885-76642907 TTTGATTTGAAAATATCTGGTGG - Intergenic
1110749806 13:79099817-79099839 TGACATCTGAAAACATATGAAGG + Intergenic
1112111395 13:96303657-96303679 TGAGATCTGAAAAAATATCAAGG + Intronic
1112169419 13:96955229-96955251 TGTGATCTGCACATCTCTGAAGG - Intergenic
1112777379 13:102859885-102859907 TGTGGTCTGAAAATATTAAATGG + Intronic
1115612337 14:35060797-35060819 TGTGCTCTGAAAATATTAAATGG + Intronic
1116165713 14:41332074-41332096 TGTGATCTGAAAGTATTAAAAGG - Intergenic
1116309780 14:43310018-43310040 TTTGATGTGAAAATATTGGAAGG + Intergenic
1116639488 14:47442791-47442813 TGTGGTCTGAAAATATTAAAAGG + Intronic
1116731986 14:48635184-48635206 TGTGATCTGAAAGTCTATGGGGG - Intergenic
1116739110 14:48732739-48732761 TGTTTTATGAAAATATGTTATGG - Intergenic
1116975864 14:51115245-51115267 TATCATGTGAAAATAAGTGATGG + Intergenic
1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG + Intronic
1117214282 14:53534516-53534538 TGTCATCTGTAAATATATGAAGG + Intergenic
1117302842 14:54445399-54445421 TGTGCTCTGGTAATATGTGAAGG - Intergenic
1118118714 14:62811253-62811275 TGTTTTCTTAAAATATCTGATGG + Intronic
1118289966 14:64510744-64510766 TTTAGTCTGAAGATATGTGAGGG + Intronic
1119221719 14:72914045-72914067 TGTAATCTCCAAAAATGTGAAGG - Intergenic
1119575148 14:75713609-75713631 TGAAATTTGATAATATGTGATGG + Intronic
1120012336 14:79430983-79431005 TGTGTGCTCAAAATATATGAGGG - Intronic
1120293079 14:82602347-82602369 TATGGGATGAAAATATGTGACGG + Intergenic
1120854998 14:89204565-89204587 TTTCAACTGATAATATGTGAGGG - Intronic
1121689657 14:95867742-95867764 AGTGATCTCTAAAAATGTGATGG + Intergenic
1122496019 14:102156082-102156104 TGTGATATGAAAACATCTGTGGG - Intronic
1125093971 15:35829681-35829703 TGTGATGGGAAAATATTTAAGGG + Intergenic
1126423079 15:48496099-48496121 CCTGATCTAAAAACATGTGAAGG - Exonic
1127426081 15:58858917-58858939 TGTACTCTTTAAATATGTGAAGG + Exonic
1127741261 15:61908834-61908856 TGTTATCTCAAAACATGTAAGGG + Intronic
1128420800 15:67489864-67489886 TGTGTTCTCATAATATCTGAAGG + Intronic
1128443155 15:67732145-67732167 AGTAATCTGGAAAGATGTGAAGG + Intronic
1129494884 15:75969662-75969684 AGTGATCTGGCAAAATGTGAGGG + Intronic
1130195366 15:81775366-81775388 TGTCATCTGAAATTATATCACGG + Intergenic
1130633771 15:85597077-85597099 TGTGATCAAAAAATTTGTAATGG + Intronic
1131287435 15:91072999-91073021 GGTGATTTGAAAATATGTGGTGG - Intergenic
1132125369 15:99219140-99219162 TGTCATTTGACAATATGTGAAGG - Intronic
1133609292 16:7418022-7418044 TGTGATCTGAAAATCTATAGAGG - Intronic
1133832182 16:9333345-9333367 TGTGATTTGAAAAGCTGTGGTGG + Intergenic
1134351497 16:13441844-13441866 TTTGACCTGAAACTATGTGTGGG + Intergenic
1135412517 16:22245833-22245855 TGTGAGCTCAAAATGTGTGGCGG + Intronic
1135676945 16:24423638-24423660 TGTGGTCTGAAAATATTAAATGG - Intergenic
1137233570 16:46593172-46593194 TGTTATCTGCAAATAAGTGCAGG - Intronic
1138320964 16:56111405-56111427 TGTGATCTCAGAATCTGTGTGGG + Intergenic
1140725981 16:77812726-77812748 AGGGATCTGAAGATATGTTAGGG - Intronic
1141243365 16:82283785-82283807 TGTGCCCTGACAATTTGTGAGGG + Intergenic
1143089563 17:4441179-4441201 TGTTAGCTGAAAATGTGTGGAGG + Intronic
1143161421 17:4874235-4874257 TGTGCTCAGGAAATATGTAATGG + Intronic
1143613843 17:8038020-8038042 TATCATCTGAAATTATGTGTTGG + Intergenic
1144320671 17:14116242-14116264 TGAGATCTGAAAATATTAAACGG + Intronic
1146471607 17:33129407-33129429 TGCTATCTGCAAATATTTGAAGG + Intronic
1146597270 17:34180732-34180754 TGCCATCTGAAAATCTTTGATGG - Intergenic
1147429099 17:40360958-40360980 TGTGCTCAGTAAATATGTGTTGG - Exonic
1150269738 17:63856023-63856045 TGGGACCTGAAAATATGCTAAGG - Intergenic
1151127278 17:71858764-71858786 TTTGATCTAAAAATATTAGAGGG - Intergenic
1153890870 18:9513689-9513711 TGTCTTCTGGAAACATGTGAAGG + Intronic
1154089787 18:11346178-11346200 GGTGATCTGAAAATATTAAATGG - Intergenic
1155479009 18:26265094-26265116 TGGGAGAAGAAAATATGTGATGG + Intronic
1156555879 18:38067944-38067966 GGTGTTTTGAAAATATGTAAAGG - Intergenic
1156818691 18:41343570-41343592 TGTGGTATGAGAATATGTGGTGG + Intergenic
1157373456 18:47139796-47139818 TGTGACCCCAAAATATGTGGAGG - Intronic
1157482114 18:48061675-48061697 TTGGAGCTGAAAATATGTCATGG - Intronic
1158957980 18:62559836-62559858 TGTGAGCTGAAAGTATTTGGGGG + Intronic
1162585242 19:11554223-11554245 TGTGATGTGAAAATGTGAGTGGG - Exonic
1164216090 19:23150438-23150460 TGTGTGCTGAAGATTTGTGATGG - Intergenic
1167919944 19:52774800-52774822 TGTGTTCTGACAAAATGTTAAGG + Intronic
1168578255 19:57531873-57531895 TGTGGTCTGAAAATATTACATGG - Intronic
1168654960 19:58120490-58120512 TGTGGTCTGAAAATATTAAATGG + Intergenic
925291880 2:2753417-2753439 TGTAATCACAAAATACGTGAAGG + Intergenic
926069966 2:9879504-9879526 TGTGGTCTGAAAATATACAATGG - Intronic
926409892 2:12591934-12591956 TGAGTTCTCAAAATATCTGATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928425745 2:31176401-31176423 GGTGCTCAGAAAATATTTGATGG + Intronic
928973146 2:37052923-37052945 TGTGATTTGAAAATATTAAATGG - Intronic
929013417 2:37470614-37470636 TGTGGTCTGAAAATATTAAATGG + Intergenic
929072788 2:38050457-38050479 TGGGACCTGAAAAAATATGATGG - Intronic
929849490 2:45571072-45571094 TATGCTCTGAAAAGATCTGAGGG + Intronic
929982117 2:46691174-46691196 TGTGGTCTGAAAACATTCGATGG - Intergenic
930362087 2:50394112-50394134 TGTGACCTCCAAATATGAGAAGG + Intronic
930834598 2:55779738-55779760 TGTGGTCTGAAAATATTAAATGG + Intergenic
930976569 2:57469623-57469645 TGTGATAGGAAAATATGAGAAGG - Intergenic
931179821 2:59888144-59888166 TCTGATCTTTAAATCTGTGAAGG - Intergenic
931473999 2:62569976-62569998 TGTGGTTTGAAAAGAAGTGAAGG + Intergenic
932542172 2:72666435-72666457 TGTGATCTGAGAGTGTGTGTGGG - Intronic
933043561 2:77503002-77503024 TGTAAAATGAAAATCTGTGAAGG + Intronic
933178917 2:79208033-79208055 TCTTATCTTGAAATATGTGAGGG - Intronic
933356735 2:81219616-81219638 TGTTGTCTGAAAATATCTGCAGG + Intergenic
933408995 2:81900875-81900897 TTTGATATGACAATATGTGCAGG - Intergenic
934064551 2:88328876-88328898 TATGATCTGAAAATATTAAATGG - Intergenic
935026433 2:99281666-99281688 AGGTATTTGAAAATATGTGAGGG - Intronic
935171811 2:100616043-100616065 TGTGCTCAGAAGAGATGTGATGG - Intergenic
936067929 2:109346045-109346067 TGTGATCAGAAAAAATGGGAAGG - Intronic
936392107 2:112084658-112084680 TGTGAACTGAAAACATCAGATGG + Intronic
936398043 2:112143946-112143968 TTTGCTCTGAGAATATGTGTTGG + Intronic
936786214 2:116096628-116096650 TGAAATCTGAGAATATTTGATGG - Intergenic
938818631 2:134930636-134930658 TGTGTTCTCAAAATGTGTGAGGG + Intronic
940308031 2:152247329-152247351 TGTGGTCTGAAAATATTAAATGG + Intergenic
940883783 2:158970737-158970759 TGTGATTTGACAATAAGAGATGG + Intronic
941356501 2:164499692-164499714 TGTGATCTCAAAGTATGGGCTGG - Intronic
941490084 2:166132801-166132823 TATGATATAAAAATATCTGAGGG + Intergenic
942842946 2:180385802-180385824 AGTGTTCTGAAATTATGTAATGG - Intergenic
942956070 2:181774885-181774907 TGTGGTCTGAAAATATTAAATGG - Intergenic
944014592 2:195020028-195020050 TATTATCTGAAACTATGTAATGG + Intergenic
944286629 2:197957606-197957628 GATGGTCTGAGAATATGTGAGGG - Intronic
944642159 2:201738855-201738877 TGTGATGTCAACATTTGTGAAGG + Intronic
944958266 2:204837853-204837875 AGTGGTCTTCAAATATGTGATGG - Intronic
945040115 2:205736856-205736878 TTTGATCAGAAAACATATGAAGG + Intronic
947386198 2:229593086-229593108 TCTGATCTGAGATTCTGTGAGGG - Intronic
948255271 2:236563862-236563884 TGTGATCAGGAAGTATCTGAGGG + Intergenic
948622149 2:239242819-239242841 TGTGATTTAAAAATATGTCTTGG - Intronic
948651479 2:239448155-239448177 TGTTATCTCAATAAATGTGAGGG - Intergenic
948964768 2:241369993-241370015 TGGGAACTGAAAAAAAGTGATGG + Intronic
1168964082 20:1888500-1888522 TCTCATCTGAAAATAGGTGAGGG - Intergenic
1169178086 20:3536929-3536951 TGGAATCTGAAACTATGTTAAGG + Intronic
1170048201 20:12109892-12109914 TGTTATCTGAAAAGAGGTGATGG - Intergenic
1170277620 20:14609357-14609379 TGGGATCTGAACAAATGGGAAGG + Intronic
1172557667 20:35856596-35856618 TGTGATCTGTACTTATATGAAGG + Intronic
1173981337 20:47226355-47226377 TCTGATCTGATACTACGTGAGGG + Intronic
1174036380 20:47671006-47671028 TGTGCCCTGAAAATGTGTGGAGG - Intronic
1175365382 20:58451081-58451103 TGTGCTCTGAATATATTTAAAGG + Exonic
1176036474 20:63040825-63040847 TTTCTTCTGTAAATATGTGATGG + Intergenic
1176650116 21:9538341-9538363 TAGGAACTGAAAAAATGTGATGG + Intergenic
1178027696 21:28487006-28487028 TATGCTCTGAAAATATGGAATGG - Intergenic
1178106056 21:29320441-29320463 TGTGATCAAAAAATATTTGGAGG + Intronic
1178185447 21:30214471-30214493 TGTGATCTAAGAAAAAGTGATGG - Exonic
1179013851 21:37577566-37577588 TGTGATTTGAAAAGATGTTTTGG - Intergenic
1179398315 21:41061164-41061186 TGTGGTCTGAAAATATTAAATGG + Intergenic
1179948440 21:44696210-44696232 ATTGATGTGAAAATATCTGATGG - Intronic
1180651101 22:17377924-17377946 TTTGATCTGAAAATCTGTTGTGG + Intronic
1183875272 22:40775129-40775151 TTTAAGCTGAGAATATGTGATGG - Intronic
1184784183 22:46663837-46663859 GGTTAACTGAAAATATGAGACGG + Exonic
949926283 3:9044529-9044551 TGTGGCCTGAAAATATGAAATGG - Intronic
949939520 3:9144054-9144076 ATTGATCTGAAAATATTGGAAGG - Intronic
950994259 3:17479098-17479120 TGTCATCTGAAAACATGCAAAGG + Intronic
952219626 3:31312253-31312275 TCTGATCTGAAGAGATCTGAGGG - Intergenic
952474283 3:33690638-33690660 TGTGGTCTGAAAATATTATATGG + Intronic
953486070 3:43297693-43297715 TTTGATGTGAAAAAATGTAAAGG + Intronic
953993056 3:47498642-47498664 AGTGAGCTGAAAATATGGGTTGG - Intronic
956103505 3:65792809-65792831 TGTGGTCTGAAAATATCCAATGG - Intronic
957838884 3:85639914-85639936 TATGATCTGAAAACTTGAGAAGG + Intronic
957945940 3:87062975-87062997 TGAGTTCTGAAAATATGTGAAGG + Intergenic
959752222 3:109851585-109851607 TGTGACATCAAAATATGGGAGGG + Intergenic
960023515 3:112982856-112982878 TGTGATTTCAAAATGTGTGTAGG + Intergenic
960122468 3:113961000-113961022 TATGATCTGGAACTATTTGAGGG + Exonic
960188855 3:114678868-114678890 TGTGATCTGAAAAGTAGTAAAGG + Intronic
961068632 3:123899342-123899364 TGGTATCTGAAACCATGTGAGGG - Intronic
961233887 3:125346622-125346644 TGAGTTCTCAAAAGATGTGATGG + Intronic
962076926 3:132091638-132091660 TGTGATGTGCAGATATGTCAGGG + Intronic
962140043 3:132780658-132780680 TGTGATCAGAAAATTTGTTAGGG - Intergenic
963208051 3:142656727-142656749 TGTGATCTGTAAACTTGTAATGG + Intronic
963350139 3:144141381-144141403 TGTGGTCTGAAAATATTACATGG - Intergenic
963494675 3:146044362-146044384 TGTGGTCTGAAAATATTAAATGG - Intergenic
965384378 3:168028288-168028310 TGACATCAGAAAACATGTGATGG - Intronic
965635821 3:170779160-170779182 TGTGAACAGAAAATATGGGCAGG + Intronic
966341445 3:178929161-178929183 TAAGATCAGAAAATATGAGAAGG + Intergenic
967275381 3:187768992-187769014 TCTGACTTGAAAATATGTGCAGG - Intergenic
967365192 3:188678493-188678515 AGTGAGCAGAAAATCTGTGAAGG + Intronic
967692158 3:192487976-192487998 TGTGCTCTGGACATATGAGATGG + Intronic
969163535 4:5282881-5282903 TGTGGTCTGCAAATATGAAATGG - Intronic
969198855 4:5585627-5585649 TGTGTACTGTAAATATGTGCAGG - Intronic
969783007 4:9425416-9425438 TGAGATATGAAATTATATGATGG + Intergenic
970203630 4:13633918-13633940 TGTGGTCTGAAAATATTAAATGG - Intergenic
971151498 4:24037469-24037491 TGTGATCTGAAAAGATCTTGTGG - Intergenic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
972032690 4:34481335-34481357 TCTGATGTGAATATCTGTGAAGG + Intergenic
972709819 4:41583988-41584010 TGTGATCTGTAAATATGATAGGG + Intronic
973602997 4:52560474-52560496 TGTGATCTGATAATTTATAAGGG - Intergenic
973722167 4:53735644-53735666 TGAGTTCTCAAAATATCTGATGG + Intronic
974305569 4:60134396-60134418 TGTGATCTGAAAATAATGAATGG - Intergenic
975454096 4:74569104-74569126 TCTGATTTAAAAATACGTGAAGG + Intergenic
976005111 4:80420365-80420387 AGTCATCTCAAAATATGTCAAGG + Intronic
976843477 4:89459483-89459505 TGTGGTCTGAAAATATTAAATGG + Intergenic
977376001 4:96204773-96204795 TGTTATTTGGAAATATGAGATGG + Intergenic
977534611 4:98242483-98242505 TGTGGTCTGAAAATATGAAATGG + Intergenic
978609580 4:110522631-110522653 TGTTTTCTGAAATTTTGTGAGGG - Intronic
978743957 4:112170710-112170732 TGTGGTCTGAAAATATTAAATGG - Intronic
979385192 4:120056799-120056821 TTTGATCTGAAAACTTGTTAAGG - Exonic
979587241 4:122435226-122435248 TGAGAACTGAAAAAATTTGATGG + Intergenic
979931817 4:126641232-126641254 GGTGACCTGAAAATATGTCCTGG + Intergenic
980449815 4:132956563-132956585 TGAGGTCTGAAAAGATGTTACGG + Intergenic
980708712 4:136535461-136535483 TGAGAGGTGATAATATGTGAAGG + Intergenic
980725301 4:136751213-136751235 TGTGATATGAAAATATTACATGG - Intergenic
981043107 4:140241333-140241355 TTTGAGCCGACAATATGTGAAGG - Intergenic
981876132 4:149548274-149548296 TCTGATCTTAATATTTGTGAAGG - Intergenic
983081362 4:163388930-163388952 TGTGCTCTGCAAATCTCTGAGGG - Intergenic
983942186 4:173546281-173546303 ACTGATCTGAAAATAGGGGAAGG + Intergenic
984313046 4:178088530-178088552 TGAGATATGAAAGTATGAGAAGG - Intergenic
984376345 4:178935852-178935874 TCTGCTCTGAAAAGATGTTAAGG - Intergenic
985004209 4:185516758-185516780 GGGGATCTGAGAATCTGTGATGG + Intronic
986829631 5:11561334-11561356 TTTGATCTGAAAATAGGTTCTGG + Intronic
986942290 5:12968586-12968608 TGTCATCTGTAAATCTTTGATGG + Intergenic
986991954 5:13564626-13564648 TGTGTTCTTACAAGATGTGATGG + Intergenic
988009008 5:25458977-25458999 TGTGGTCTGAAAATATTAAATGG - Intergenic
988064078 5:26212596-26212618 TTTAAGCTGAAAATGTGTGAAGG + Intergenic
988835563 5:35028996-35029018 TGTAATCTAAAAATATGTTTGGG - Intronic
988864212 5:35317092-35317114 TGTGCTCTGCAGATATGTGGTGG + Intergenic
991157144 5:63452091-63452113 TTTGATTTTCAAATATGTGAGGG + Intergenic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
993661863 5:90647433-90647455 TGTGATCTGAAAATATGTGATGG + Intronic
994726002 5:103436334-103436356 TCTAATATGAAAATATGTCAAGG - Intergenic
995155652 5:108909385-108909407 TGTGATCTGAAACTAAGGAAAGG + Intronic
995453741 5:112330998-112331020 AGTCATCTTTAAATATGTGAAGG + Intronic
995562775 5:113401145-113401167 TGTGACCTGAAATGATCTGAAGG - Intronic
995835829 5:116398552-116398574 ATTCATCTGAAAACATGTGAAGG - Intronic
995999583 5:118342737-118342759 TGTGATCTGCAGCCATGTGATGG - Intergenic
996189744 5:120525181-120525203 AGTGATATGTAAATATGAGAGGG + Intronic
997785146 5:136703822-136703844 GGAGATCAGAAAATATGTCATGG - Intergenic
998992395 5:147832286-147832308 TTTCATCTGAGAATATGTGCTGG + Intergenic
999313668 5:150569969-150569991 TGTGATCAGAGAGTATGTGGAGG - Intergenic
1000656946 5:163890682-163890704 TTTTTTCTGAAAATATGTGAAGG + Intergenic
1001953928 5:175835178-175835200 TATGATCTAAACGTATGTGATGG - Intronic
1002960326 6:1908283-1908305 CGTGATCTGAAAATATTAAATGG - Intronic
1003346409 6:5272001-5272023 TATGTTCTGAAAATATGTAATGG + Intronic
1003729999 6:8810726-8810748 CTTGATCAGAAAATATATGAAGG - Intergenic
1004888417 6:20073799-20073821 TGAGAGCTGAGAAGATGTGAAGG + Intergenic
1005571636 6:27151157-27151179 TCACATCTAAAAATATGTGAAGG + Intergenic
1006092461 6:31636192-31636214 TGTGATCTGAAAATAAATTGTGG - Exonic
1006278176 6:33022709-33022731 TGTGCTCTGAAAAGCTGTGCGGG + Intergenic
1009306812 6:62101463-62101485 TGTGTTGTGAATATATGTCAAGG + Intronic
1009850614 6:69193275-69193297 TGTGATATGAAGCAATGTGATGG + Intronic
1009924177 6:70099728-70099750 TTTAATGTGAAAATATGTGCTGG + Intronic
1010106833 6:72180238-72180260 TGTGCTCTGAGAGGATGTGATGG + Intronic
1010416130 6:75614000-75614022 TGTTTTCTTAAAATATGTCAAGG - Intronic
1011350114 6:86413863-86413885 TGTGAACTGTAAGTATGGGAAGG + Intergenic
1012792852 6:103722059-103722081 TGTGATTTAAAAATATATGTAGG - Intergenic
1012887602 6:104863024-104863046 TGTGATATAAAAATATATCAGGG + Intergenic
1013383755 6:109603552-109603574 TGAGATCTGAAACTCTGTGCTGG + Intronic
1013503407 6:110774569-110774591 TGTGGTCTGAAAATATTAAATGG - Intronic
1013554878 6:111246167-111246189 GGTGCTTTGAAAATGTGTGAGGG + Intergenic
1014641549 6:123916670-123916692 TGGCATCTAAAAATCTGTGAAGG - Intronic
1014968676 6:127788288-127788310 GGTAATCTGAAAATATTTCATGG + Intronic
1015235982 6:130971698-130971720 TGTGGTCTGAAAATATTACATGG - Intronic
1015363494 6:132369848-132369870 TGTGATCTGAAAATATTAAATGG - Intronic
1016163610 6:140911510-140911532 TGTTATTTGAAATTTTGTGAAGG + Intergenic
1017115768 6:150975213-150975235 TATGATGTCTAAATATGTGATGG + Intronic
1017598564 6:156056982-156057004 TGTGATCTCAAATTTGGTGATGG - Intergenic
1018169569 6:161133963-161133985 TGTGACCTGAACATGGGTGAAGG + Exonic
1020495292 7:8844382-8844404 TGTGGGCTGGAAAGATGTGAAGG + Intergenic
1020798021 7:12699790-12699812 TATGGTCTGTAAATGTGTGAGGG + Intergenic
1023174344 7:37421337-37421359 GGAGATCAGAAAATATGTGGTGG - Intronic
1023429172 7:40071514-40071536 TGTAATCTGAAACCATATGAAGG + Intronic
1023573450 7:41596953-41596975 TGTGATATGACAGTATGTGTTGG - Intergenic
1024492842 7:50005472-50005494 TGTGACATCAAAATATGGGAAGG + Intronic
1027873055 7:83733707-83733729 ACTGATCTATAAATATGTGATGG + Intergenic
1027987683 7:85315194-85315216 TGTTAAATGAACATATGTGAAGG + Intergenic
1028035834 7:85980797-85980819 TGTCATCTGAAAATATGTGATGG - Intergenic
1028308245 7:89293857-89293879 TGTGATCTCAAAATAAGAGGTGG - Intronic
1028485397 7:91352031-91352053 AGTGCTCTGAAAATATGAGGAGG + Intergenic
1029908988 7:104124080-104124102 TGTGGTCTGAAAATATTAAATGG - Intergenic
1029908998 7:104124184-104124206 TGTGGTCTGAAAATATTAAATGG - Intergenic
1029909009 7:104124288-104124310 TGTGGTCTGAAAATATTAAATGG - Intergenic
1031081213 7:117258663-117258685 TGTGGTCCAAAAATAGGTGAGGG + Intergenic
1031697146 7:124872390-124872412 TGTGATCTATAAATATTTAATGG + Intronic
1032856942 7:135842737-135842759 TGAGGTCTGAAAATTGGTGAAGG + Intergenic
1033639592 7:143248837-143248859 TCTGCTCTGCAAATATGTGGGGG - Intronic
1034185386 7:149172220-149172242 TGTGATCTGAAAATATTAAATGG + Intronic
1035630002 8:1099972-1099994 TGAGATCTGAAAATATTAAATGG + Intergenic
1036836055 8:12068642-12068664 TGTGATATGAAATTATATGATGG - Intronic
1036857897 8:12315212-12315234 TGTGATGTGAAATTATATGATGG - Intergenic
1037093267 8:14949018-14949040 TGTGATTTGGCAGTATGTGAGGG - Intronic
1037641959 8:20752995-20753017 AGTGATCTGAGAATATGTTCTGG - Intergenic
1038123114 8:24640767-24640789 GCTGATCTGAAAATAAATGAGGG - Intergenic
1038967363 8:32589433-32589455 TGGGATCTGCACATATGTGATGG + Intronic
1039025592 8:33254445-33254467 TTTGATCTGATAAAATGTGGGGG - Intergenic
1039993828 8:42513949-42513971 TGTGTTCTGAATACAAGTGATGG + Intronic
1040134622 8:43838345-43838367 TGTTTTTGGAAAATATGTGAAGG + Intergenic
1041646824 8:60261608-60261630 TGTGATCTCAAAATAAGGCATGG - Intronic
1042022635 8:64384985-64385007 TGTGGTCTGAAAATATTAAATGG + Intergenic
1042165837 8:65945212-65945234 AGTGAACTGTAAGTATGTGATGG + Intergenic
1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG + Intergenic
1045549411 8:103157102-103157124 GGTGATCTGAATATGTGTGTAGG + Intronic
1045875601 8:106977402-106977424 TGTGATCAGAAAATATAAAATGG + Intergenic
1046677233 8:117123241-117123263 TGTCATCTGAATAAATGAGAAGG - Intronic
1047838964 8:128726886-128726908 TGTGATCTGATACTATCTCAAGG + Intergenic
1047898537 8:129394309-129394331 TGTAGTCTGAAAATATTAGATGG - Intergenic
1052349246 9:27441661-27441683 TGTGGTCTGAAAATATTAAATGG - Intronic
1053601240 9:39611755-39611777 TGTGGTCTGAAAATATTAAATGG - Intergenic
1053858887 9:42365550-42365572 TGTGGTCTGAAAATATTAAATGG - Intergenic
1054252297 9:62730683-62730705 TGTGGTCTGAAAATATTAAATGG + Intergenic
1054566412 9:66765182-66765204 TGTGGTCTGAAAATATTAAATGG + Intergenic
1055271953 9:74570822-74570844 TATCATCAGAACATATGTGAAGG + Intronic
1203627858 Un_KI270750v1:41895-41917 TAGGAACTGAAAAAATGTGATGG + Intergenic
1186804370 X:13125299-13125321 AGAGATCTGAAAATTTGTGTGGG - Intergenic
1186904782 X:14099554-14099576 TGTGAGCTGAAATTATATGAGGG + Intergenic
1187107112 X:16254621-16254643 TGTGATGTGGAGATGTGTGATGG + Intergenic
1187193327 X:17057464-17057486 TGTCCTCATAAAATATGTGAAGG + Intronic
1187232703 X:17437602-17437624 TGTGATCTAAAAAGATGCCAGGG - Intronic
1187718633 X:22129290-22129312 TGTGTTCTGAAAATATTAAATGG - Intronic
1188033857 X:25295141-25295163 TGAGATCGGGAAATATGGGATGG + Intergenic
1188635978 X:32432094-32432116 TGTCACCTGAAAATGTGTGTTGG - Intronic
1188794949 X:34451935-34451957 TGTGATCTCAAAATAGGGAACGG + Intergenic
1188868270 X:35341692-35341714 TGGGATATCAAAATATGTAAAGG - Intergenic
1189008612 X:37021352-37021374 GCTGAACTGAAAATATGTTAGGG + Intergenic
1189040110 X:37533672-37533694 GCTGAACTGAAAATATGTTAGGG - Intronic
1189732428 X:44035371-44035393 TGTGAAATGTAAATCTGTGATGG - Intergenic
1189908116 X:45782670-45782692 TGTGCTCTGAAAATCAGGGAAGG + Intergenic
1191724430 X:64264235-64264257 TGTGATTTCAAAGTATTTGATGG - Intergenic
1193368552 X:80664433-80664455 TGTGATCTGAAAATATTAAATGG - Intergenic
1193827000 X:86238376-86238398 AGTGCTATGAAAATATTTGAAGG - Intronic
1193827155 X:86240803-86240825 TGTGTTCTCACAATATCTGATGG + Intronic
1194172820 X:90608931-90608953 AATTATATGAAAATATGTGATGG + Intergenic
1194778564 X:97994977-97994999 TGTGATCTTAAAATATCTAAGGG + Intergenic
1194962187 X:100248484-100248506 TTTGATATGAAAATATTTAATGG + Intergenic
1196110408 X:111941078-111941100 GGTGATGTGAATATATATGAAGG - Intronic
1196624376 X:117861329-117861351 TGTGATCTGAGAATTTGTATTGG + Intergenic
1197392543 X:125884677-125884699 TGAGGTCTGACAATATCTGATGG + Intergenic
1198990364 X:142507048-142507070 TCTGTACTGAAAATATGTAATGG - Intergenic
1200341302 X:155399477-155399499 TGTGAACTGAAAATGACTGAAGG - Intergenic
1200519047 Y:4186650-4186672 AATTATATGAAAATATGTGATGG + Intergenic
1201271599 Y:12261095-12261117 TGTGAGCTGAAACACTGTGAGGG - Intergenic