ID: 993666831

View in Genome Browser
Species Human (GRCh38)
Location 5:90709012-90709034
Sequence AGCTATGTGTTAAAATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993666831 Original CRISPR AGCTATGTGTTAAAATATGA TGG Intronic
900627797 1:3617203-3617225 AGCTAGGTCTGGAAATATGAAGG + Intergenic
908025554 1:59947887-59947909 AGCTAAGTTTTCAAATATTATGG - Intergenic
911859153 1:102924292-102924314 AGCTCTGTGTTACAGTATAAAGG + Intronic
914241220 1:145854373-145854395 AGGTATGGGTTTAATTATGAAGG + Intronic
914666468 1:149837052-149837074 AGCTATCTTTTAAAAACTGAGGG - Intergenic
914669299 1:149856746-149856768 AGCTATCTTTTAAAAACTGAGGG + Intronic
916181989 1:162093211-162093233 AGGAATGTGTTAAAATAAGAAGG + Intronic
917323817 1:173811624-173811646 GACTATGTGTTAAAGAATGAAGG - Intronic
917411741 1:174766302-174766324 AGCCATGTGCTAAAGGATGAAGG - Intronic
919307773 1:195865402-195865424 AAATATTTGTTAAAAAATGATGG - Intergenic
919609040 1:199722270-199722292 AGCTGCGTGATAAAATATGAAGG - Intergenic
919742911 1:200991333-200991355 AGCTGTGCGTTAAAAAAAGAAGG - Intronic
921225110 1:213011087-213011109 AGAAATGTGTTCAAATATGAGGG + Intronic
921996366 1:221423687-221423709 ATCTAGGTTTTAAAATATGTTGG - Intergenic
1064676343 10:17764035-17764057 AGCTGAGTGTTAATATATGTTGG + Intronic
1066410534 10:35164529-35164551 AGCAATGTTTTAAAATATCTAGG - Intronic
1067272099 10:44801427-44801449 ATATATGTTTTAAAATATAAAGG + Intergenic
1067539840 10:47143539-47143561 AGCTCTGTCTTAAAGCATGAAGG + Intergenic
1068406762 10:56599632-56599654 AGCAATGATTTAAAATATGATGG - Intergenic
1068787526 10:60992314-60992336 AGATGTGTGCTAAGATATGAAGG + Intronic
1074487350 10:113898655-113898677 AACTATGTCTTAAAAGATAAGGG - Intronic
1078652884 11:13212402-13212424 AGGTATGTGGTAAAAGATTATGG + Intergenic
1078902863 11:15657717-15657739 TACTATGTGTTAAAATTTGAAGG + Intergenic
1079785830 11:24671481-24671503 TGCTAGGTGTTAAAGTCTGAAGG + Intronic
1079927140 11:26508283-26508305 AGTTATGTGATAAAATGTGTTGG + Intronic
1080296843 11:30739744-30739766 AGCACTGTTTTAAAATTTGATGG + Intergenic
1080495693 11:32816380-32816402 AGTTATATGTTAAAAGAAGAGGG - Intergenic
1081305390 11:41505358-41505380 AGCTATTTTTTAAAAAAAGAAGG - Intergenic
1082717440 11:56631995-56632017 TGCTGTGTCTTGAAATATGAAGG + Intergenic
1082820397 11:57541016-57541038 AGCAATGTCTTAAAGTAAGAGGG - Intergenic
1083525114 11:63356657-63356679 AGCTTTTTGTTAAAATATTTAGG + Intronic
1085113610 11:73910631-73910653 GGCTATTTTTTAAAATGTGAGGG - Intronic
1086065035 11:82734641-82734663 TGCTATGTGTTAATAAAAGATGG - Intergenic
1088129753 11:106473086-106473108 AGCTATGTTTAAGAATATTAAGG + Intergenic
1088228499 11:107648001-107648023 AACTACATATTAAAATATGAAGG - Intronic
1088360814 11:108987339-108987361 AGCTGAGTATTAAAATAAGATGG - Intergenic
1089971476 11:122696918-122696940 TGCTAGCTGTTAAAATAGGAGGG + Intronic
1089993292 11:122882090-122882112 AACTATGTGTAACAATATGGAGG - Intergenic
1090506888 11:127324748-127324770 AGCTATGTTTTAATATATTTAGG - Intergenic
1092937099 12:13374332-13374354 AGCTTTGGACTAAAATATGAAGG - Intronic
1093700623 12:22216165-22216187 ACCGATCTGTTAAAATAAGAAGG - Intronic
1094381142 12:29844516-29844538 AGATATGTGTATATATATGAAGG + Intergenic
1095714274 12:45324843-45324865 AGCTATAGCTTAAAATTTGAGGG + Intronic
1097350346 12:58542209-58542231 AGATATGTTTGAAAAGATGAAGG + Intergenic
1098010999 12:66051793-66051815 AGCAATGTTTTAAAATGTGGTGG - Intergenic
1098556559 12:71825452-71825474 AGCTTTGTCTTCAAATGTGATGG + Intergenic
1098904251 12:76145563-76145585 AGCTATGTGTTCAGACATGGTGG + Intergenic
1099044584 12:77699929-77699951 AGCTATGTTTTAAAATCAGATGG + Intergenic
1099070102 12:78035670-78035692 AGCTTTGAGTCAAAATATCAAGG + Intronic
1099214890 12:79841374-79841396 TGCTATGTATTAAAATATATAGG - Intronic
1099465636 12:82984196-82984218 AGATATGTTTTAAACTTTGAGGG + Intronic
1099505478 12:83470976-83470998 AGCAATGAGTTAACACATGAAGG - Intergenic
1101924944 12:108963805-108963827 AGCTATTTTTTAAAATGTGTTGG - Intronic
1104546405 12:129716785-129716807 AGCTATGAGATAAAAAATGTGGG + Intronic
1105420891 13:20251425-20251447 AGCAAGCTATTAAAATATGATGG - Intergenic
1105503980 13:20994379-20994401 AGCTATGTTTTAAACACTGAAGG + Intronic
1107373889 13:39781528-39781550 AGCTGTGAGTCAAAATAAGAAGG - Intronic
1108220757 13:48231682-48231704 CGTTCTGTGTTAAAATAAGATGG - Intergenic
1108788673 13:53939548-53939570 AGCCCTGTGTTAAAATCAGAAGG - Intergenic
1109011183 13:56946846-56946868 ATCACTGTGTAAAAATATGATGG - Intergenic
1109409979 13:61950844-61950866 TGCAATATTTTAAAATATGATGG + Intergenic
1110792042 13:79597101-79597123 AGCACTGTTCTAAAATATGATGG + Intergenic
1111428693 13:88124177-88124199 AGCTGAGTGTTAGAAGATGATGG - Intergenic
1115684983 14:35787580-35787602 AGCTATGTGTTAGAAAACAAAGG - Intronic
1116676274 14:47910094-47910116 TGATATGTGTTAATATATTAGGG - Intergenic
1118032813 14:61834881-61834903 AGATGTGTGTTGATATATGATGG + Intergenic
1118851839 14:69590015-69590037 AGCTATGGGAAAATATATGAAGG - Intergenic
1120026233 14:79587484-79587506 AGCAATGTGTTAAAGTTAGATGG + Intronic
1120158811 14:81123369-81123391 AGCTATGTGGGAAAAAATAATGG - Intronic
1120447544 14:84619205-84619227 ATATATTTGATAAAATATGATGG - Intergenic
1120749977 14:88188200-88188222 AGCTGAGTGTTAAACAATGATGG - Intronic
1121854931 14:97259419-97259441 AATTATGAGTTAAATTATGAGGG - Intergenic
1125988718 15:44083414-44083436 TGCTATGTGTTTAAATTTGGAGG + Intronic
1126019072 15:44382085-44382107 AGATATGCTTTAAAATATCAAGG - Intronic
1126607155 15:50489652-50489674 ATCTGTTTTTTAAAATATGAAGG + Intronic
1127128075 15:55832907-55832929 AGCTAAGTGTTAGTAAATGATGG + Intronic
1127238143 15:57078855-57078877 ATCTATGTGATCAAATACGATGG - Intronic
1128422087 15:67502530-67502552 ATATATGTGTTAAAAGATAATGG - Intergenic
1128523751 15:68393306-68393328 AGCTATATTTTTAAAAATGAAGG + Intronic
1131855549 15:96589783-96589805 GGCTATGTCTTAAAATATGTTGG + Intergenic
1132306189 15:100814799-100814821 AGCTTTGTTTAAAAATTTGAGGG - Intergenic
1132997904 16:2832863-2832885 AGCTAAGTCTTAAAGGATGAAGG + Intronic
1138186647 16:54982459-54982481 ATCAATATGTTAAAAGATGATGG - Intergenic
1140343349 16:74187833-74187855 TCCAATGTGTTAAAATATCATGG + Intergenic
1140729971 16:77847464-77847486 ACCCATGGGTTAAAATATGGTGG - Intronic
1141328752 16:83088314-83088336 AGCTATGAGTTTAAATGTCAGGG + Intronic
1144169188 17:12642801-12642823 AGATATGAGTTAAATTTTGAAGG - Intergenic
1144489671 17:15697906-15697928 AACTGTGTGTCAAAATATGATGG - Intergenic
1144911294 17:18684050-18684072 AACTGTGTGTCAAAATATGATGG + Intergenic
1145789236 17:27614855-27614877 AGCAATGTGTTAAAAAGGGAAGG - Intronic
1146459648 17:33035814-33035836 AGATTTGTGTAAAAATTTGAGGG + Intronic
1149057408 17:52382412-52382434 TGTTATGTATTAAAATATGTGGG + Intergenic
1150472002 17:65445395-65445417 AGCCATTGGTTAAAATTTGAGGG - Intergenic
1153239682 18:3019215-3019237 TACTATGTATGAAAATATGAGGG + Intergenic
1157729326 18:49990045-49990067 AACTATGAGTTAAAACATGCTGG + Intronic
1159312976 18:66734295-66734317 AGCTATGTTTTAAAATCCGTTGG - Intergenic
1164942038 19:32258108-32258130 AGAAATGGGTTAAATTATGAAGG - Intergenic
1164975123 19:32567243-32567265 AGTATTGTGTTAAAATATGAAGG + Intergenic
1165755264 19:38289170-38289192 AGCGATATGTTCAACTATGAAGG + Exonic
1166571593 19:43800102-43800124 AGCTATGACTTAGAATAGGAAGG + Intronic
925538818 2:4944411-4944433 AGATAGCTGTTAAAATAGGAAGG + Intergenic
927600735 2:24438096-24438118 TTATTTGTGTTAAAATATGATGG - Intergenic
929183057 2:39064491-39064513 AGCTTTGTATTAAAATAATAAGG + Intronic
930259600 2:49129689-49129711 AGCTGTGTTTTCAAATATAAAGG + Intronic
932266681 2:70373702-70373724 AGCTATGTATAAAAATATTTTGG + Intergenic
932268349 2:70387436-70387458 AACTCTGTGGTAAAATTTGATGG - Intergenic
933081475 2:77993182-77993204 AGCTATGTGTCTTAATATAATGG - Intergenic
933140701 2:78789496-78789518 AGCTATGAGTTAAGAAATGTGGG + Intergenic
933976135 2:87512525-87512547 TGCTGTGTCTTCAAATATGAGGG + Intergenic
936317688 2:111438279-111438301 TGCTGTGTCTTCAAATATGAGGG - Intergenic
936880469 2:117244360-117244382 AGCCATGTGTTAACATTTAAAGG - Intergenic
937216985 2:120319028-120319050 AGCTTTGTTTTCAAATATAATGG + Intergenic
938137240 2:128769620-128769642 AGCTTTGTGTTAAGACATTAAGG + Intergenic
938361998 2:130695145-130695167 AGTTAATTTTTAAAATATGAAGG + Intergenic
939240262 2:139549170-139549192 AGCCATGGCTAAAAATATGATGG - Intergenic
939574212 2:143876695-143876717 AGCACTATGTTAAAGTATGAGGG - Intergenic
940978696 2:159976810-159976832 AGTGATGTTTTAAAAGATGAAGG - Intronic
943170997 2:184399571-184399593 CGATATTTGTTAAAATATAAGGG + Intergenic
943226954 2:185189940-185189962 CATTATGTGTGAAAATATGAAGG + Intergenic
943408946 2:187521507-187521529 AGCTATGGGTATTAATATGAAGG - Intronic
944112761 2:196151888-196151910 AACTATGTATTAAAATAAGAAGG + Intronic
944409710 2:199427540-199427562 AGATATTTATTAAAATATTATGG + Intronic
944874189 2:203944750-203944772 TGCTATGTGCTAAAATATACTGG + Intronic
946314440 2:218900468-218900490 AGCATTGTGTTAGATTATGAAGG - Intergenic
1170012089 20:11735367-11735389 ATCTATGTTGTATAATATGAAGG + Intergenic
1170393307 20:15899656-15899678 TGCTTTCTGTAAAAATATGATGG - Intronic
1172396463 20:34609668-34609690 AACCATCTGTTTAAATATGAAGG - Intronic
1173203757 20:40974532-40974554 AGCTATGTAATATAATTTGAAGG + Intergenic
1176926941 21:14761711-14761733 GGCTATATTTTAAAATATGAAGG - Intergenic
1177088678 21:16739402-16739424 AGCTATGTGCTAAAACCAGAAGG - Intergenic
1179341867 21:40519179-40519201 AGGCATGTGTAAATATATGACGG + Intronic
1183884024 22:40861988-40862010 AACTATCTGTTAAAACATGGTGG - Exonic
949627980 3:5889240-5889262 AGGTATCTGTTAAAATACCATGG + Intergenic
949722492 3:7006836-7006858 TACTATGTGTTAGAATCTGAAGG + Intronic
950366158 3:12485567-12485589 AGCTATATGTTAAAATCAGCTGG + Intronic
950908022 3:16556707-16556729 AGGTATGTGTAAGAACATGAGGG - Intergenic
951008880 3:17652663-17652685 AGTTATGTTTTAAAACCTGAAGG - Intronic
952244044 3:31565775-31565797 AGGTATGTCTTAAAAAATCATGG - Intronic
952869299 3:37884225-37884247 TGCTATGTTTTATAACATGAGGG - Intronic
956121148 3:65967216-65967238 AGCTATGTGATAAAACAGCATGG + Intronic
957021035 3:75126344-75126366 AGCTATGAGTACAAATATCAGGG - Intergenic
957320602 3:78625361-78625383 ACCAATGTTTTAAAATAAGATGG - Intronic
957472177 3:80672382-80672404 AGCTTTCTGTTAAAATAAAAAGG - Intergenic
957715208 3:83919659-83919681 TGTTATTTGTTAAATTATGAGGG + Intergenic
958033881 3:88148391-88148413 AGATAAGTGCTAAAATATGTTGG - Intronic
958992568 3:100864227-100864249 ACATAGCTGTTAAAATATGAAGG + Intronic
961233752 3:125344791-125344813 AACTATCTGCTAAAACATGATGG - Intronic
961375124 3:126459971-126459993 GGCTATGTTTTAGACTATGAAGG - Intronic
966542366 3:181106393-181106415 TTCTATGTGTTCAAAGATGATGG - Intergenic
966579392 3:181542874-181542896 AGCATTTTTTTAAAATATGAAGG + Intergenic
968888177 4:3347775-3347797 AGCTATGGTTTAAAATCTGGTGG + Intronic
970146835 4:13044714-13044736 TGCAATGTGTTAAAAGATAAGGG - Intergenic
970251340 4:14119259-14119281 AGCTTTGTCATAAAATCTGAGGG + Intergenic
970769014 4:19587635-19587657 AGCTGTAATTTAAAATATGAAGG + Intergenic
970939782 4:21618369-21618391 AGGTATGTCAAAAAATATGAAGG + Intronic
971907822 4:32750382-32750404 AGCTATGTCTTAAAAGAGGTAGG + Intergenic
972242439 4:37207823-37207845 AAATATGTGTTAAACTATGAGGG + Intergenic
973558437 4:52109700-52109722 AGCTAGGTCTTAAAATACAATGG - Intergenic
973578130 4:52313317-52313339 AGCTGTGTGATAAAATATGAGGG + Intergenic
973738357 4:53894576-53894598 TGCTATGTTTAAAAATATGTTGG - Intronic
974331045 4:60479701-60479723 AGCTATTTGTTAGCATATGTGGG - Intergenic
975431830 4:74301872-74301894 AGCTTTGTAGTAAAATATAAAGG - Exonic
976012926 4:80513917-80513939 ACCCATATGTTTAAATATGAAGG + Intronic
976101027 4:81564153-81564175 AGCTATGTGTACAAAAATTATGG - Intronic
976922977 4:90460628-90460650 AGATATTTGTTAAGATGTGAAGG - Intronic
977332862 4:95659913-95659935 AGCAGTGTCTTAAACTATGAAGG - Intergenic
978961863 4:114689343-114689365 ACCTATGTGCTAAAATATATGGG + Intergenic
979003318 4:115256150-115256172 TGCTATCTGATAAAATATGTGGG - Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
979302487 4:119102844-119102866 AGCTATGTTTCAAAACAAGAGGG + Intergenic
981603657 4:146520606-146520628 ATCTTTTTGTTAAAACATGATGG - Intronic
981762023 4:148205055-148205077 AACTATTTGTTAAGATTTGAAGG + Intronic
982842545 4:160209607-160209629 AGCTTTGTGTTCAAGAATGATGG - Intergenic
983270151 4:165551628-165551650 AGCTATATGCTAAAATATTTAGG + Intergenic
984077549 4:175202104-175202126 AGCTATGTGATAAATAATTATGG + Intergenic
985386061 4:189449299-189449321 TGCTGTGGGTTTAAATATGACGG - Intergenic
986474579 5:8114467-8114489 AGGTATGAATTAAAATATGCTGG + Intergenic
986888673 5:12273078-12273100 AGCTATGTTTTCAAATATTTAGG - Intergenic
987357777 5:17080456-17080478 AGCTTTGTTTTAAAATAAAATGG + Intronic
987967976 5:24901199-24901221 AAATATGTGTACAAATATGATGG - Intergenic
989238662 5:39178804-39178826 TGCAATGTGTTAAAAGATGTTGG - Intronic
989316318 5:40083000-40083022 AGCTATTTGTTAAAATAGATGGG + Intergenic
990068874 5:51753723-51753745 AACTATATTTTAAAATATGTAGG - Intergenic
990605466 5:57405411-57405433 AGAAATGAGTTAAAATATGAGGG - Intergenic
990855338 5:60260431-60260453 TGCTCTGTGTTAAAATATGCTGG - Intronic
990962137 5:61405205-61405227 AGCTATGTTTGAAGATATGGTGG + Intronic
993010299 5:82474882-82474904 TGGCATGTGTTAAAAAATGAAGG - Intergenic
993666831 5:90709012-90709034 AGCTATGTGTTAAAATATGATGG + Intronic
993809341 5:92456503-92456525 AGCTATATGTTCAACTAAGAGGG - Intergenic
993864623 5:93177542-93177564 AGCTATGTTTTATCATTTGAAGG - Intergenic
994178027 5:96733606-96733628 TGCTATGTACTAAAATAAGAAGG - Intronic
994253073 5:97559806-97559828 AGCTATGGCTTAAAAAATGCAGG - Intergenic
994276206 5:97841311-97841333 AGGTATGTATTATAAAATGATGG - Intergenic
994512137 5:100717903-100717925 AGATATATGAGAAAATATGAAGG - Intergenic
995093180 5:108204872-108204894 AGCTAGGTTTTAAGACATGAAGG - Intronic
1000516584 5:162242644-162242666 AGGGATGTGTTAAGATATAAGGG + Intergenic
1000516586 5:162242663-162242685 AGGGATGTGTTAAGATATAAGGG + Intergenic
1000678249 5:164150466-164150488 ATATATGTGTTTAAATAAGAAGG + Intergenic
1000720586 5:164701505-164701527 AAATATGTCTTAAAAAATGAAGG + Intergenic
1000782863 5:165505586-165505608 AGCTATATAATAAAATAAGATGG - Intergenic
1002038093 5:176488888-176488910 AGCCATTTGATAAAATATTAGGG + Intronic
1009439254 6:63656812-63656834 AACAATGAGTTAAAATTTGAAGG - Intronic
1009809930 6:68648313-68648335 AGGCATGTTATAAAATATGAAGG + Intronic
1010174627 6:73013599-73013621 AGCTATTTGTGAAAATGGGAGGG - Intronic
1010600013 6:77813142-77813164 AGCTCTGTGTTAAAAAATACTGG - Intronic
1011413398 6:87090509-87090531 TTATATGTGTTAACATATGATGG + Intronic
1012666647 6:101979367-101979389 AGCTATTTGTTTCAATATCATGG - Intronic
1013523888 6:110957197-110957219 ACCTATGTGTTAAAAAATAGAGG + Intergenic
1014365030 6:120529118-120529140 AGCTATGCATTAAAATTTGAGGG + Intergenic
1016490827 6:144599803-144599825 AGCTATGTGTGATAAGATGGGGG - Intronic
1017701054 6:157072248-157072270 AGCTATGTGTTAAAATCTCCAGG + Intronic
1018404028 6:163457930-163457952 AGAAATCTGTTACAATATGATGG + Intronic
1018861934 6:167717266-167717288 AGGTCTGTGTTAAAAAAAGAAGG - Intergenic
1019887308 7:3916494-3916516 ATCTTTGTCTTAAAAGATGATGG + Intronic
1020622782 7:10537915-10537937 AGTTCTGTGTTAAAAGCTGATGG + Intergenic
1021292041 7:18857923-18857945 AGCTAATTTTTTAAATATGAGGG + Intronic
1021834303 7:24652913-24652935 ATCTATGTTTTAAATTTTGAGGG + Intronic
1021984234 7:26083664-26083686 GGCTTTGGGTTAAAATAAGAAGG + Intergenic
1022768529 7:33443331-33443353 AGCTACGTCTCAGAATATGAAGG - Intronic
1025220054 7:57099813-57099835 AGCTATGTGTTGTAATCTGTAGG + Intergenic
1025630834 7:63271393-63271415 AGCTATGTGTTGTAATCTGTAGG + Intergenic
1025651637 7:63475221-63475243 AGCTATGTGTTGTAATCTGTAGG - Intergenic
1029520311 7:101056931-101056953 AGCAATATGTTAAAAAATGTAGG - Intronic
1030653349 7:112139449-112139471 AGTTATTTTTTAAAATATAAAGG + Intronic
1031733337 7:125325542-125325564 AAATATGTGTTAAAGTATTAAGG + Intergenic
1033549625 7:142434883-142434905 AACTATTTCTTAAAACATGAAGG + Intergenic
1034067031 7:148146931-148146953 AGCTATGTGTTAACATTTCCTGG + Intronic
1035421515 7:158732791-158732813 AACTATGTGTAAATATATTAAGG - Exonic
1035814979 8:2529348-2529370 AGGTCTGATTTAAAATATGACGG + Intergenic
1037353782 8:17995468-17995490 AGCTCTGTGGTATAATTTGAAGG + Intronic
1038899232 8:31823587-31823609 AGGCATGTGTTAAAATCTGCTGG - Intronic
1040802381 8:51357613-51357635 ATCTATGTGTCAAAATAACATGG + Intronic
1040975945 8:53194786-53194808 AGCTATGTCTTGAAATCAGACGG - Intergenic
1046030832 8:108782093-108782115 AGCTGTGTGTTAAAAAAAGAAGG - Intronic
1046575480 8:116023137-116023159 AGCTATGTTGTAAAATATTCAGG + Intergenic
1047317758 8:123750004-123750026 AGTTATCTGTTAAAAAGTGATGG - Intergenic
1048319820 8:133389698-133389720 AGCTGTGTGCTAATATTTGATGG + Intergenic
1051999072 9:23254318-23254340 AGCTTTGTTTTAAACTCTGAAGG + Intergenic
1052092092 9:24341122-24341144 AGCTATATATTAGAATATGGAGG - Intergenic
1052499154 9:29267219-29267241 AGGTATGTGTTGAAATTTGAGGG + Intergenic
1053317601 9:37065376-37065398 AGATATCAGTTAAGATATGATGG + Intergenic
1053321939 9:37106524-37106546 AGATATCAGTTAAGATATGATGG + Intergenic
1053625076 9:39861521-39861543 AGCTATATGATTAAAAATGAAGG + Intergenic
1053879794 9:42581707-42581729 AGCTATATGATTAAAAATGAAGG - Intergenic
1053892871 9:42712613-42712635 AGCTATATGATTAAAAATGAAGG + Intergenic
1054218821 9:62389177-62389199 AGCTATATGATTAAAAATGAAGG - Intergenic
1054231897 9:62519992-62520014 AGCTATATGATTAAAAATGAAGG + Intergenic
1055011817 9:71574995-71575017 TGCTTTGTTTTAAAATATCATGG - Intergenic
1055244120 9:74219879-74219901 AGCCATGTTTAAAAATCTGATGG + Intergenic
1055392236 9:75835418-75835440 AGCTATGTGTTACAGTAGGGAGG + Intergenic
1057623597 9:96657590-96657612 AGCTATGTGTAGAAGTTTGATGG - Intergenic
1058812135 9:108650923-108650945 AGCTATCTACAAAAATATGAAGG + Intergenic
1059021011 9:110576478-110576500 AGCTATGTACCAAACTATGACGG + Intronic
1059077463 9:111209337-111209359 AGATATGTGTTGAAATGTTACGG - Intergenic
1059590041 9:115648992-115649014 GTCTATGAGTTAGAATATGATGG + Intergenic
1059645412 9:116261848-116261870 CGATATGTGTTAAAGAATGACGG + Intronic
1061733338 9:132634440-132634462 AGGTATGTGTTAAAGTATTTAGG - Intronic
1186221878 X:7357919-7357941 GGCTCTGTGTTAAAATCTGAAGG + Intergenic
1186337236 X:8603293-8603315 ATCTATTCGTTAACATATGAAGG - Intronic
1186370874 X:8946263-8946285 AGCTGGTTGTGAAAATATGATGG - Intergenic
1186875389 X:13811470-13811492 AGCTATTATTTAAAATATTAAGG + Intronic
1187383840 X:18829792-18829814 AGCTATGTATTCAAACATTATGG + Intergenic
1187666914 X:21623549-21623571 GGCTATGTGTGAAAATATCAAGG - Intronic
1188211905 X:27436135-27436157 AGATATGTGGAAAAATAAGATGG + Intergenic
1189457790 X:41209053-41209075 AGATATATGTTGAAGTATGAAGG - Intronic
1191869088 X:65730357-65730379 AACTTAGTGTTAAAATATTAAGG - Intronic
1193317287 X:80077994-80078016 AGCTCTGTGTGACAATGTGAAGG + Intergenic
1193915668 X:87359792-87359814 AGCTATGAATGAAAAAATGAAGG + Intergenic
1194002457 X:88448462-88448484 AGCTATGTGTTAAAGTTTTCAGG - Intergenic
1194397767 X:93406715-93406737 ACCTATGTTATAAAATATGAGGG + Intergenic
1194712028 X:97246823-97246845 AGGTAAGTGTTATAATTTGATGG - Intronic
1196028763 X:111072728-111072750 AGCAATCTGATAAGATATGATGG + Intronic
1197037142 X:121887781-121887803 AGCCATGTCTGAAAATATCAAGG - Intergenic
1197821514 X:130545327-130545349 ATCTATGAGTTGAAATATCAGGG - Intergenic
1199446952 X:147935850-147935872 AGCAATGTATTAAAAAGTGAAGG - Intronic
1199532205 X:148862427-148862449 AGATATTTTTTAAAAAATGATGG + Intronic
1200712192 Y:6496563-6496585 GGTAATGTTTTAAAATATGAAGG - Intergenic
1200947088 Y:8853881-8853903 ACATAGGTGGTAAAATATGAAGG - Intergenic
1201686142 Y:16704768-16704790 AGCTATGTGAACAAATATAAGGG - Intergenic