ID: 993671563

View in Genome Browser
Species Human (GRCh38)
Location 5:90766797-90766819
Sequence ATACTCCAGCCAAGGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993671563_993671569 10 Left 993671563 5:90766797-90766819 CCTGAGAACCTTGGCTGGAGTAT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 993671569 5:90766830-90766852 ACTGTAGGATGCGATTTTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
993671563_993671565 -5 Left 993671563 5:90766797-90766819 CCTGAGAACCTTGGCTGGAGTAT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 993671565 5:90766815-90766837 AGTATCAACCAACCCACTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993671563 Original CRISPR ATACTCCAGCCAAGGTTCTC AGG (reversed) Intronic
901204465 1:7485889-7485911 ACACTCCAGACCAGCTTCTCAGG + Intronic
901522033 1:9792590-9792612 AGACTCCAGCCACGGGTGTCGGG + Intronic
901873606 1:12153154-12153176 ACACTCCAGCCAAGGTGCCTTGG + Intergenic
903335160 1:22619739-22619761 ATACCCCAGCCCTGGTCCTCTGG - Intergenic
906584683 1:46965885-46965907 TCACTCCAGCCAGGGTTCTATGG - Intergenic
907266366 1:53264010-53264032 AATCCCCAACCAAGGTTCTCTGG - Intronic
913430873 1:118789261-118789283 CCACTCCTGCCAATGTTCTCTGG + Intergenic
918378700 1:183933817-183933839 ATTCTCCAGCCTGGCTTCTCTGG - Intronic
920375146 1:205504394-205504416 ATCCCCTAGCCAAGGCTCTCAGG + Intergenic
924269154 1:242314688-242314710 ATACTCCAGTCAAGGTGATATGG - Intronic
1066228002 10:33403389-33403411 ATACTCCAGCCTAGGTGATAGGG - Intergenic
1066715745 10:38284081-38284103 ATACTCCAGTCAAGGTGATATGG + Intergenic
1068783567 10:60945556-60945578 ACCCTCCAGCCAAGATTCCCAGG + Intronic
1075095092 10:119466062-119466084 AATCTCCTGCCAGGGTTCTCTGG - Intergenic
1076881890 10:133243666-133243688 ATAGTCCTGCCAAGAATCTCTGG + Intergenic
1078469772 11:11577596-11577618 AAGCTCCAGCCCAGCTTCTCTGG - Intronic
1079097021 11:17517534-17517556 AAACTCCTGAGAAGGTTCTCCGG - Intronic
1080809664 11:35691068-35691090 ATTCTCCAGTCCTGGTTCTCTGG - Intronic
1084905399 11:72342341-72342363 AAACTCCTGCCAAGGATCTCTGG + Intronic
1097575794 12:61390819-61390841 ACACTCCAGCCTTGGTACTCAGG - Intergenic
1102659337 12:114512391-114512413 AGTCTCCATCCAAGGCTCTCTGG - Intergenic
1104933033 12:132350352-132350374 ATGCTCATGCCATGGTTCTCTGG + Intergenic
1115749221 14:36471696-36471718 ATACTCCAACACAGGATCTCAGG + Intergenic
1117219653 14:53590211-53590233 ACACTCAAGCCAAGACTCTCAGG - Intergenic
1121894219 14:97630585-97630607 ATTTTCCACCCAATGTTCTCTGG + Intergenic
1122206779 14:100151610-100151632 CTGCTCCAGCAAAGCTTCTCTGG - Intronic
1124913293 15:33944424-33944446 CTTCTCCAGACAAGTTTCTCTGG + Intronic
1124915087 15:33962403-33962425 TTACTCAAGCCAGAGTTCTCAGG + Intronic
1126416526 15:48423501-48423523 ATGCTCCAGCCAAGCTCCTTGGG - Intronic
1127566081 15:60189766-60189788 AAACTCCAGCCGAGTTTCTCGGG + Intergenic
1128531431 15:68451030-68451052 AACCTCCAGCCAAGGATTTCTGG - Intergenic
1130330456 15:82918287-82918309 ATACTCAGGCCACGGTGCTCTGG + Intronic
1131896898 15:97043392-97043414 AAAACCCAGCCAAGGTTCCCAGG + Intergenic
1133745537 16:8683760-8683782 AGACTCCAGGCATGGTTGTCTGG + Intronic
1142722515 17:1786128-1786150 TTCCTCCAGCCACAGTTCTCAGG + Intronic
1143337113 17:6179638-6179660 ATACTCCAGCAAAGATCCTTTGG + Intergenic
1145005334 17:19334275-19334297 ATCCTCCAGCACAGGTGCTCTGG - Exonic
1151234397 17:72708524-72708546 ATGTACCAGTCAAGGTTCTCTGG - Intronic
1153677737 18:7470458-7470480 ATACTCCTGCCACGGTGCTCTGG + Intergenic
1155153624 18:23140912-23140934 AGACACAAGCCAAGGTTCTCAGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1166228145 19:41410128-41410150 ATACACCAGCGAAGCTACTCAGG - Intronic
930424290 2:51193940-51193962 CCACTCCAGCCAGGGTTCTATGG - Intergenic
931838704 2:66127060-66127082 TTCCTCCAGCCAGGGTTCTCAGG + Intergenic
934725334 2:96613411-96613433 ATCCTCCTGCCAAGGTTCTAAGG + Intronic
935214216 2:100963325-100963347 ATACTCCAGCCAGTGTTTTAAGG - Intronic
938561053 2:132472218-132472240 CTACTCCAGATAAAGTTCTCAGG - Intronic
938678223 2:133660741-133660763 ATATTCCATCCTAGTTTCTCAGG - Intergenic
939715593 2:145579770-145579792 ATATTACAGTCAAGGTTCTTTGG + Intergenic
942611784 2:177749581-177749603 ATACTCCAGCCAACTTTCTCAGG + Intronic
942933743 2:181528580-181528602 ATACTACAGACAAGGTCTTCTGG - Intronic
946648740 2:221868599-221868621 CAACTCCAGCCAAGGTTATAGGG + Intergenic
948587258 2:239027219-239027241 ATTCTCCTGCCTTGGTTCTCTGG - Intergenic
1172513003 20:35513623-35513645 ATCCTCCAGCCCTGGTTCTCAGG + Exonic
1177184410 21:17777689-17777711 TTACTCCAGCCAAAGTACACAGG + Intergenic
1178301710 21:31458784-31458806 CTACTTCAGCTTAGGTTCTCAGG + Intronic
1180818813 22:18810809-18810831 ATGCTCCAGGCCAGGTTCTGTGG - Intergenic
1181205037 22:21245264-21245286 ATGCTCCAGGCCAGGTTCTGTGG - Intergenic
1184887020 22:47352561-47352583 AAACTCCAGCAAAGGGTCCCAGG + Intergenic
1203221888 22_KI270731v1_random:50151-50173 ATGCTCCAGGCCAGGTTCTGTGG + Intergenic
1203268941 22_KI270734v1_random:36662-36684 ATGCTCCAGGCCAGGTTCTGTGG - Intergenic
952354504 3:32571289-32571311 ATACTCCAGCCCAGGGTTGCAGG - Intergenic
962358134 3:134712682-134712704 AAATGCCAGCCAAGGATCTCCGG - Intronic
963258225 3:143167910-143167932 ATTTTCCAGCCACGGTCCTCGGG - Intergenic
965204486 3:165704022-165704044 ATATTCTAGACAATGTTCTCTGG - Intergenic
968437200 4:599907-599929 CCACTCCAGCCAGGGTTCTATGG - Intergenic
969406115 4:6993218-6993240 ATATTACAGACAAGGCTCTCAGG - Intronic
971892318 4:32540851-32540873 ATTCTCCTGCCCTGGTTCTCAGG + Intergenic
973547332 4:51995097-51995119 ATACAGCAGCCAAGGCTGTCCGG - Exonic
974157623 4:58094570-58094592 ATGCTACAGCAAAGGTTATCAGG + Intergenic
978291092 4:107141715-107141737 ATATTCCAGGCAATGTTCTCAGG - Intronic
982075035 4:151730413-151730435 ATACTACAGCTAATGCTCTCTGG + Intronic
982397209 4:154925569-154925591 CCACTCCAGCCAAGGTTCTATGG - Intergenic
983166120 4:164478870-164478892 CTTCTCCAGCCAAGCTTCTATGG - Intergenic
984644844 4:182208794-182208816 AGACTCCACCAGAGGTTCTCAGG + Intronic
993671563 5:90766797-90766819 ATACTCCAGCCAAGGTTCTCAGG - Intronic
998152197 5:139763929-139763951 ATTCTCCAGCAAAGGTAGTCTGG + Intergenic
1000023606 5:157339812-157339834 ATATTCCAGACAAGTTTCTAAGG + Intronic
1000722758 5:164728991-164729013 ATACTCCAGCGAGGGTACTGAGG + Intergenic
1004031167 6:11870851-11870873 AGACTCCAGACAAGGTTCCTGGG - Intergenic
1007496559 6:42263708-42263730 TCACTCCAGCCAAGGGACTCAGG - Intronic
1007627624 6:43255233-43255255 TTCCTCCAGCCCAGGGTCTCTGG - Intronic
1010392326 6:75351823-75351845 ATACTGCAAACAAGGTTCTAAGG - Intronic
1010684573 6:78838137-78838159 ATAATCCATACAAGGTTCTGGGG + Intergenic
1020406631 7:7842818-7842840 ATATGCCAGCCATGGTACTCAGG + Intronic
1020570760 7:9858401-9858423 ATACTCCAGCCCAGGTGATAGGG - Intergenic
1021916997 7:25444021-25444043 CCACTCCAGCCAGGGTTCTACGG - Intergenic
1022795123 7:33726018-33726040 AAATTCCAGCCAAGATTTTCTGG - Exonic
1023666455 7:42527702-42527724 CCACTCCAGCCAGGGTTCTATGG + Intergenic
1023876551 7:44289322-44289344 AAACTCCAGCCATGCTGCTCAGG - Intronic
1037219164 8:16496860-16496882 AAACTCCAGCCAGGCTCCTCTGG + Intronic
1041064715 8:54071223-54071245 ATACTCCTGGAAAGGATCTCAGG + Intronic
1043363165 8:79499515-79499537 CCACTCCAGCCAGGGTTCTATGG - Intergenic
1045034527 8:98167108-98167130 ATGCCCCAGCCAAGGCTCTCAGG - Intergenic
1048580053 8:135723238-135723260 TTTGTCCAGTCAAGGTTCTCTGG + Intergenic
1050308389 9:4328646-4328668 AGATTCCAGCCCAGGCTCTCTGG - Intronic
1052516324 9:29485228-29485250 ATACTCAAGGCAAGGGTTTCTGG + Intergenic
1061348697 9:130046731-130046753 ACACTCCAGCCACTGTACTCCGG + Intergenic
1189652292 X:43203491-43203513 CCACTCCAGCCAGGGTTCTATGG - Intergenic
1190506663 X:51133303-51133325 ATACTCCAGGCACAGTCCTCGGG - Intergenic
1191078850 X:56487478-56487500 CCACTCCAGCCAGGGTTCTATGG - Intergenic
1192950293 X:76009559-76009581 CTATTCCTGCCAATGTTCTCTGG - Intergenic
1193625826 X:83819256-83819278 CGACTCCAGCCAGGGTTCTATGG - Intergenic
1193647634 X:84088804-84088826 CCACTCCAGCCAAGGTTATTGGG - Intronic
1193985696 X:88238040-88238062 AGACTCCAGACAGGGGTCTCCGG - Intergenic
1193993767 X:88341116-88341138 AAACTCCAGCCAAATTTTTCTGG - Intergenic
1195672432 X:107481246-107481268 ATACTCCAGGCAAGAATATCTGG - Intergenic
1195709752 X:107764653-107764675 ATAATCCACCCAAGTCTCTCTGG - Intronic