ID: 993671759

View in Genome Browser
Species Human (GRCh38)
Location 5:90769069-90769091
Sequence GAAGACAACCCCTTCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993671759_993671762 15 Left 993671759 5:90769069-90769091 CCATGTGAGAAGGGGTTGTCTTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 993671762 5:90769107-90769129 CAAAGGAGCCTGTCAGATGAGGG No data
993671759_993671760 -2 Left 993671759 5:90769069-90769091 CCATGTGAGAAGGGGTTGTCTTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 993671760 5:90769090-90769112 TCAGATGAGACAATTTGCAAAGG No data
993671759_993671761 14 Left 993671759 5:90769069-90769091 CCATGTGAGAAGGGGTTGTCTTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 993671761 5:90769106-90769128 GCAAAGGAGCCTGTCAGATGAGG 0: 1
1: 0
2: 2
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993671759 Original CRISPR GAAGACAACCCCTTCTCACA TGG (reversed) Intronic
900359310 1:2280393-2280415 GACCACAGCCCCTTCTCACAAGG + Intronic
900922165 1:5679906-5679928 CAAGGCAACCCCTTCTTAGAAGG + Intergenic
901123389 1:6912723-6912745 GAAGACTACCCCAGTTCACAGGG + Intronic
902134487 1:14293054-14293076 GAAGACAACCAGTTTGCACAGGG - Intergenic
917638365 1:176958645-176958667 GAGGCCAACCCTTGCTCACATGG + Intronic
918426321 1:184413767-184413789 GAAGATAACCCCACCACACAGGG - Intronic
919517882 1:198550090-198550112 GAAAACACCCTCTTCTCACCAGG - Intergenic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
924245449 1:242079368-242079390 GAAGACAGCCCCTCCTCTCAGGG - Intergenic
1063234287 10:4096672-4096694 GAGGACAACCCCATCTGACATGG - Intergenic
1063369744 10:5513339-5513361 GCAGGCAACCCATTGTCACAGGG + Intergenic
1065385569 10:25130145-25130167 GAAGAAAACCTCTTCACCCAGGG + Intergenic
1067224808 10:44368693-44368715 GAAAATACCCACTTCTCACACGG + Intergenic
1070399112 10:76037090-76037112 AAAGACACACCCTTCTCACAGGG - Intronic
1074709280 10:116163664-116163686 GAACACAGTCCCTTCTCGCACGG + Intronic
1075070808 10:119318874-119318896 CAAGACAGCCTCTTCTCCCATGG + Intronic
1075814973 10:125257910-125257932 CATGACAACCCCTTCCCACGTGG + Intergenic
1076032316 10:127170083-127170105 GAACAGAACCCCTGCTGACAGGG + Intronic
1079656456 11:22991911-22991933 GAAGAGAACCACTTCTTCCAAGG - Intergenic
1083181254 11:60987203-60987225 GAAGAGAACAGCTTCTCAGAAGG - Intronic
1083376950 11:62231396-62231418 GAAGACAGGCCCTTCTGGCAGGG - Intergenic
1084461713 11:69299892-69299914 AGAGACAACGCCTCCTCACAGGG - Intronic
1085302204 11:75465369-75465391 GAAGACTCCCCTGTCTCACAGGG + Intronic
1086217606 11:84402678-84402700 AAAGACCACCCCGGCTCACACGG + Intronic
1087686342 11:101269899-101269921 AATGACAACCACTTCACACAAGG - Intergenic
1088030637 11:105245046-105245068 GAATACAACCATTTCTCACATGG - Intergenic
1088427310 11:109718109-109718131 GAAGAAAACCCATGTTCACATGG + Intergenic
1089654894 11:119940191-119940213 GAAAACAGGCCCTTCACACAAGG + Intergenic
1091640985 12:2237126-2237148 GAAGACCAGACCTTATCACATGG + Intronic
1094394100 12:29986336-29986358 TAAAACAACCCATTCTCATAGGG + Intergenic
1095927430 12:47592867-47592889 GAAGACACCAGTTTCTCACAGGG - Intergenic
1100090716 12:90966755-90966777 AAAGACAACCCACTCCCACATGG - Intronic
1100580131 12:95930979-95931001 GAAGAGAAAGCCTTCTCTCAAGG - Intronic
1100676322 12:96872258-96872280 GAAGGCAACCCATTATCACTTGG - Intronic
1103409335 12:120699720-120699742 GAAGACTAGCCCTGCCCACAGGG + Exonic
1104496090 12:129240829-129240851 GAAGACAACACCTTCTAGCTAGG + Intronic
1106360798 13:29028749-29028771 GAAAACAATCCCTTCCCTCATGG - Intronic
1107012568 13:35683013-35683035 GCAGACAACCTCCCCTCACAGGG + Intergenic
1114175498 14:20315861-20315883 CAAGAAAACCCCGTCTCAAAAGG + Intronic
1114421156 14:22584267-22584289 GAAGACAGCCCCTGCCCTCAAGG + Intronic
1114661019 14:24344879-24344901 GAAAACAAACCCTCCACACATGG + Intergenic
1115688608 14:35822638-35822660 TAAGACAACCTCTGCTCTCAAGG + Intergenic
1116048432 14:39773867-39773889 GAAGACAGCCCTTTCACAAAGGG - Intergenic
1121155749 14:91682504-91682526 CAAAACAGCTCCTTCTCACATGG + Intronic
1126435619 15:48634427-48634449 GATGACAACCCCTTCACTCCCGG - Intronic
1128418608 15:67470030-67470052 GGAGACAACCTCGTCACACAGGG - Intronic
1131000511 15:88936340-88936362 AACAACAAACCCTTCTCACAGGG + Intergenic
1131070747 15:89464257-89464279 ATAGACAACCCCTTTTTACAAGG + Intergenic
1133403767 16:5507344-5507366 CAAGACAATCCCTCCTCGCATGG - Intergenic
1133715554 16:8444179-8444201 GAACACATCCTCTTCTCAAAAGG + Intergenic
1133744724 16:8677328-8677350 GAAGACATCCCCTTGTCCCCAGG - Intronic
1134154091 16:11828579-11828601 GAAGAAATTCACTTCTCACAAGG + Intergenic
1135021866 16:18969511-18969533 GAAGCCACCCCCTTCTCTGATGG - Intergenic
1137825874 16:51494306-51494328 GAAGTAAGCACCTTCTCACAAGG - Intergenic
1138935414 16:61714954-61714976 AAAGATGACCCCTTCTCAAAAGG - Intronic
1141197183 16:81868818-81868840 GGAGACCAGCCCTTCTCACTGGG + Intronic
1141754091 16:85979781-85979803 CCAGACAAGCCCTTCTCAGATGG - Intergenic
1143597628 17:7924690-7924712 GAAGCCAGCCCCTGCTCAGAAGG - Intronic
1144326763 17:14190029-14190051 GAAGACAGCCTCTTCTGAAATGG + Intronic
1144475644 17:15586893-15586915 GAAGACAGCCTCTTCTGAAATGG + Intronic
1144705671 17:17366290-17366312 TAAGACACCCCCATCTCAAAGGG - Intergenic
1145984811 17:29038356-29038378 GAAGGCTTCCCCTTCTCTCAGGG - Intronic
1146281609 17:31548909-31548931 GAAGAGAAGCCCTTATCTCAGGG - Intergenic
1153691150 18:7595098-7595120 GAAGACAAGCCATTCTCTTAAGG + Intronic
1154285534 18:13052965-13052987 GGAGACAACTCCTGCTCACAGGG - Exonic
1154561161 18:15830382-15830404 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154639746 18:16907431-16907453 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154652981 18:17089298-17089320 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154744838 18:18347704-18347726 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154804743 18:19170318-19170340 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154816017 18:19325111-19325133 GAAGACAATCCCGTTTCCCACGG - Intergenic
1154871882 18:20096274-20096296 GAAGACAATCCCGTTTCCCACGG - Intergenic
1157801550 18:50625554-50625576 GAAGACAGCCCCTTCCTTCATGG + Intronic
1159664999 18:71146990-71147012 GAATACAACCACTGCTCTCATGG + Intergenic
1160419199 18:78732549-78732571 CAAGCCGGCCCCTTCTCACAGGG + Intergenic
1162005851 19:7778571-7778593 GAAAACAAACCCTGTTCACAGGG - Intergenic
1163120177 19:15212629-15212651 AAAGAAAGCCCCTTCTCAGATGG - Intergenic
1164776142 19:30855119-30855141 AAGGTCATCCCCTTCTCACAGGG - Intergenic
1165065559 19:33226082-33226104 CAAGACAATCCCTGCTCTCAGGG + Intergenic
1165220240 19:34310441-34310463 CAAGACAGCCTGTTCTCACAGGG - Intronic
1166194626 19:41197767-41197789 GAAGAAAACCCCTGCGCAGAAGG - Exonic
926233489 2:11022291-11022313 GAAAAGAACCCCTGCACACAGGG + Intergenic
927231049 2:20824563-20824585 GAAAACAACCCACTCTCTCAGGG + Intergenic
930739049 2:54810778-54810800 GAAGACAGCCCCTGCCCTCACGG + Intronic
931236066 2:60413452-60413474 GCCCACAACCCCTTCTCACCAGG - Intergenic
936227342 2:110668736-110668758 GAAGGCCACCTTTTCTCACAGGG + Intronic
936696280 2:114952852-114952874 AATGACAACTCCTCCTCACATGG - Intronic
937253831 2:120541031-120541053 GAATCCAGACCCTTCTCACAGGG + Intergenic
937488367 2:122339432-122339454 AAACAGAACCCCTTCTCACTTGG - Intergenic
939054509 2:137347499-137347521 GGAGACAACTCCTTTTCACTAGG + Intronic
939456926 2:142449337-142449359 GAAGAAAACCCATTAACACAAGG - Intergenic
940857024 2:158737252-158737274 GAAGTCATCCCCTTATCACTGGG - Intergenic
941159640 2:162021932-162021954 GAAGACAACCCCTTCTAGCTGGG - Intronic
947150138 2:227107199-227107221 TTAGGCAACCCCTTCCCACAGGG + Intronic
947414996 2:229885772-229885794 CAAGACAATCCCTCCTCACAAGG + Intronic
947994420 2:234515269-234515291 CAACACAACCCCTTTACACACGG - Intergenic
948583905 2:239006569-239006591 AAAGACAGCCCCTGCTCCCAGGG - Intergenic
1170697909 20:18676517-18676539 GGAGAAAACAGCTTCTCACAGGG - Intronic
1171140945 20:22742089-22742111 GAAGCCAGCCCCTTCTGACATGG + Intergenic
1171395861 20:24832707-24832729 CATGACAACCTCTTCCCACACGG - Intergenic
1172090717 20:32430104-32430126 GAAGACATCATCTTCTCACTAGG - Intronic
1180010035 21:45043553-45043575 GAAGACACCCCCTTCCTCCAGGG + Intergenic
1180148761 21:45936895-45936917 GAAGAGACCCACTTCTCAGAAGG + Intronic
1180239167 21:46488315-46488337 GAAGACAATTCCTACTCAAAGGG - Intronic
1180335347 22:11572667-11572689 GGATAAAACCCCTTCTCTCAGGG + Intergenic
1184476018 22:44721872-44721894 GAAGACCCTCCCTTCTCACCTGG + Intronic
1184899305 22:47434370-47434392 AAAGGCAACCTCTTCTCAGAAGG + Intergenic
1185372706 22:50468386-50468408 GAGGACAACCCATTCCCCCAGGG - Exonic
950518644 3:13483305-13483327 GGAGGCTACCCCTTCTCAGAAGG + Intronic
955508762 3:59658443-59658465 AAAGACAAACTCTTCTCACCAGG + Intergenic
958449898 3:94259969-94259991 GAAGACAATCCTGCCTCACAGGG + Intergenic
961490827 3:127255821-127255843 GAAGTCCAGCCCTTCTCACCGGG - Intergenic
964034925 3:152184017-152184039 GAAGACAACCAATACTCACCAGG - Intergenic
964238754 3:154566355-154566377 GAAGGCAACCCATTTTTACAAGG - Intergenic
966193015 3:177288327-177288349 GAAGATAACTCTTTCTCTCATGG - Intergenic
968443821 4:638272-638294 GAACACAACCCCATCAAACAGGG - Intronic
969322755 4:6422995-6423017 GATGACAACCCCTTCTCACTGGG - Intronic
971512668 4:27446440-27446462 GAATATAATCCCTTCACACATGG - Intergenic
972331615 4:38069315-38069337 GAAAACAACTTCCTCTCACAAGG - Intronic
974154058 4:58047471-58047493 GAAGACAAAATCTTCACACATGG - Intergenic
975825381 4:78314378-78314400 GAAGAAAAAACCATCTCACATGG - Intronic
978308780 4:107362970-107362992 GAAGGAAACTCCTTCTCTCAAGG + Intergenic
982747360 4:159118500-159118522 GAAGACAACCTTTTTCCACAGGG - Intronic
988599037 5:32622512-32622534 GACCACAGCCCCTTCTCACACGG + Intergenic
990304494 5:54481180-54481202 GAAGACAACATCTTCAGACAGGG - Intergenic
990935634 5:61145893-61145915 GAGGTCAACCCCTTCTAAAAGGG - Intronic
991060724 5:62372463-62372485 TCAGACATTCCCTTCTCACAGGG + Exonic
991473995 5:67000439-67000461 GGAGAAAACCCCTTCTTAAAGGG + Intronic
991970275 5:72134341-72134363 GCAGGCAAGCCCTTCTCACTGGG - Intronic
993671759 5:90769069-90769091 GAAGACAACCCCTTCTCACATGG - Intronic
996143852 5:119949013-119949035 GAAGATAGCCCCTCCCCACAGGG + Intergenic
997750678 5:136342435-136342457 AAACACAACCCCTACTCTCAGGG - Intronic
999940183 5:156533760-156533782 GAAGACAATCCTTTCTCCGATGG - Intronic
1001536852 5:172504150-172504172 AAAGAGAACTCCTTCTCAGAGGG - Intergenic
1003779049 6:9402682-9402704 GCAGGCAACCCCTTGTCAAAAGG + Intergenic
1004007862 6:11653451-11653473 GAATACAACCCCTCCTCCCCCGG + Intergenic
1005254323 6:23983866-23983888 GAACACAACCAGTTCTCACCAGG + Intergenic
1005387073 6:25295717-25295739 GAAGACAACACTTCCACACAGGG - Intronic
1005440913 6:25867168-25867190 GAATCCAACAACTTCTCACAAGG + Intronic
1005583921 6:27258155-27258177 AAAGTCAACCCCTTCACGCAGGG + Intergenic
1005980595 6:30833690-30833712 GAAGCCAACCCCAACTCACCTGG + Intergenic
1008492292 6:52098966-52098988 CAATACAACTCCTTCTCCCAGGG + Intergenic
1008675840 6:53817264-53817286 GAAGACAGTCCCTTCCCTCAAGG - Intronic
1011215132 6:84997702-84997724 GGAGAGAACCCCTTTTAACAGGG + Intergenic
1014574645 6:123055403-123055425 GAAAACAGACCCTTCTCATAAGG - Intronic
1018326871 6:162679717-162679739 GATAATAACCCCTTCTCAAAAGG + Intronic
1018406538 6:163489894-163489916 GAAAAAAACCATTTCTCACAGGG - Intronic
1018925506 6:168203672-168203694 GAAGACAAACGTTTCTCAAAAGG + Intergenic
1020283762 7:6664546-6664568 GAAGACAACCCCTCCTCCGAAGG + Intergenic
1021840236 7:24716526-24716548 GAACACAACCTCTTCTCATTGGG + Intronic
1027126572 7:75560571-75560593 CAAGACCAGACCTTCTCACATGG - Intronic
1027715507 7:81664416-81664438 TAATACAACCCCTTCCCCCAGGG + Intergenic
1028057498 7:86264928-86264950 GATTACAAGCCCTTCCCACATGG - Intergenic
1028692710 7:93671776-93671798 GAAGAAAACACCTTCCCAGATGG + Intronic
1030206983 7:106960591-106960613 TAAGACACTCCCTTCTGACATGG + Intergenic
1032970693 7:137160674-137160696 GAAGGCAATCACTGCTCACAAGG - Intergenic
1037562539 8:20087948-20087970 GAAGACAAACAATTCTTACAGGG + Intergenic
1042602756 8:70514295-70514317 TAAGACAACCTCTTCTCTCATGG + Intergenic
1046352324 8:113031981-113032003 GAAGAAAACGCTTTCTTACAGGG - Intronic
1047235851 8:123041742-123041764 GAAGTCAACCCCTCCCCACCAGG + Intronic
1050655451 9:7823527-7823549 GAACACAGCCCCTGCTGACATGG + Intronic
1051243270 9:15082595-15082617 GAAGACATTCACTTCTCAGAAGG + Intergenic
1051907855 9:22117366-22117388 TATGACAACCCCTCCTCCCAGGG + Intergenic
1052404117 9:28037916-28037938 GGAGAACATCCCTTCTCACAGGG - Intronic
1052633125 9:31066483-31066505 GAAGACAACCCATCCTAAAATGG + Intergenic
1056480480 9:86998733-86998755 GGTGACAATCCCTTCTCAGAAGG + Intergenic
1060155465 9:121317128-121317150 GATGAGAACCCCTTCGCCCAGGG + Exonic
1061451852 9:130671486-130671508 GCAGACAGCCCCTTCTTAGAAGG - Intronic
1191209651 X:57871687-57871709 GCAGCCCACCCCTTCCCACAGGG + Intergenic
1192081897 X:68056115-68056137 AAAGAAAAACCCTCCTCACAAGG + Intronic
1194785064 X:98073174-98073196 GAAGACAACTTCTGCTCAGAGGG + Intergenic
1200312007 X:155087258-155087280 GAAGAATACGCCTTCCCACAGGG + Intronic