ID: 993680059

View in Genome Browser
Species Human (GRCh38)
Location 5:90866008-90866030
Sequence CTGTGGTTCTTTAGCTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993680059 Original CRISPR CTGTGGTTCTTTAGCTAAGA GGG Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
911078485 1:93904385-93904407 CTGTGGTTGATTTGCTGAGACGG - Intronic
917358537 1:174151546-174151568 TTGGGGTTCTTTTACTAAGATGG + Intergenic
920234235 1:204492493-204492515 CTGTGGTGCTTCAGCTGGGATGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924168323 1:241308749-241308771 CTGTGTATATTAAGCTAAGAGGG - Intronic
924665850 1:246070815-246070837 CTGTGTTTCATTATCTAACAAGG - Intronic
1063042321 10:2356185-2356207 GTGTGTTTCTAGAGCTAAGAGGG + Intergenic
1064244029 10:13655357-13655379 CGTTGGTTCTTTATCTAATAGGG + Exonic
1066691876 10:38037119-38037141 TTTTGGTACTTTATCTAAGAGGG + Intronic
1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG + Intergenic
1074513582 10:114142381-114142403 CTGTGGTTCTTTGGCTGCCATGG - Intronic
1077593186 11:3508768-3508790 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1081521544 11:43886592-43886614 CTTTGTTTCTTTAGCAGAGAGGG + Exonic
1084249021 11:67881486-67881508 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1086332913 11:85771812-85771834 CTGTGGTGATTCAGCAAAGAGGG - Intronic
1089870583 11:121669186-121669208 TTCTGGTTCATTAGCTGAGACGG - Intergenic
1090973621 11:131663545-131663567 CTCTGGTTCTCTAGCTTTGAGGG + Intronic
1091353295 11:134914754-134914776 CTGTTGTCCTTTATCTAAGCAGG + Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1092419306 12:8316908-8316930 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1092506480 12:9106592-9106614 CCATGGCTGTTTAGCTAAGAAGG + Exonic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1094335877 12:29352705-29352727 GTATGGTTCATGAGCTAAGAAGG - Intronic
1094649005 12:32356958-32356980 CTATAGTGCTTTTGCTAAGAAGG + Intronic
1098127770 12:67318100-67318122 TTGTGTTTTTTTAGCAAAGACGG - Exonic
1103840570 12:123860579-123860601 CTGTTGTTCTGTAGATAAGGAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105759924 13:23504207-23504229 CTGTGAATCTATAGCTAAAATGG - Intergenic
1108975780 13:56441928-56441950 CTGTGGTTGTTTGGCCAAGAGGG + Intergenic
1109224137 13:59672120-59672142 TTATGCTTCTTGAGCTAAGAAGG + Intronic
1110118438 13:71849500-71849522 ATGTGATTTATTAGCTAAGATGG + Intronic
1113080529 13:106515053-106515075 CTGTGAATCTTTAGTTAAGCAGG - Intronic
1114233196 14:20802126-20802148 CTGGAGTTCTTTTTCTAAGAGGG - Intronic
1114723904 14:24913224-24913246 CTGTGGTTTCTCAGCAAAGAAGG - Intronic
1118087978 14:62440988-62441010 CTGTGGATCTTTGGCCCAGAGGG + Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1123453874 15:20398675-20398697 CTGTTGATATTTAGCTTAGAGGG + Intergenic
1127718958 15:61681108-61681130 CTGTGGGTTTTTTGCAAAGAAGG + Intergenic
1130098931 15:80877292-80877314 CTGTGTCTCTTGAGCAAAGAAGG - Intronic
1132423772 15:101696655-101696677 CTGGGGTCCTTTGGCCAAGAGGG - Intronic
1133358821 16:5157379-5157401 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1133885419 16:9823064-9823086 CTGTTGATCTTTAGCTATCAGGG + Intronic
1134412041 16:14011195-14011217 CTGTGGTTGTTTAGCCAGAAAGG + Intergenic
1137443310 16:48514258-48514280 TTGTTTCTCTTTAGCTAAGATGG - Intergenic
1138891071 16:61144758-61144780 CTGAGGTTCTTTAGGAAGGAAGG + Intergenic
1141632759 16:85297357-85297379 CTTTGCTTCTCTGGCTAAGAAGG - Intergenic
1142033032 16:87847803-87847825 CTTTGGTTCTTCAGCTAGTAGGG - Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1151987340 17:77552411-77552433 CTGCTGTTCTTTAGCTTTGATGG + Intergenic
1156689809 18:39693843-39693865 CTGAGCTGCTTTAGGTAAGAGGG + Intergenic
1158361876 18:56683706-56683728 CCGGGGTCCTTTAGCAAAGATGG - Intronic
1160019019 18:75166050-75166072 CTGTGGATTTTTACCTGAGAGGG - Intergenic
1161394063 19:4035383-4035405 CTGAGGCCCTTTGGCTAAGACGG + Intronic
929730524 2:44486592-44486614 CTGTGGTTCTTTACCTACACAGG + Intronic
931705181 2:64941270-64941292 CTGTGCTTCTAGAGCTAACACGG + Intergenic
933069449 2:77838706-77838728 CTTTGGTTCTTGAGCTAGAAAGG + Intergenic
936241550 2:110792274-110792296 CTGGGGTTGTATAGCTAGGAGGG + Intronic
936524026 2:113230746-113230768 CTGTGGTTTTGTTTCTAAGAAGG - Intronic
939621038 2:144419379-144419401 CTGCGCTTCCTTTGCTAAGAGGG - Intronic
939861778 2:147429338-147429360 CTGTGGTTCTTTATCAACCAAGG + Intergenic
939878019 2:147599752-147599774 CTGGGCTTCTTTAGGTACGAGGG - Intergenic
940378908 2:152990752-152990774 CTGTACTTCTGTAGCTAAGATGG + Intergenic
943793098 2:191957806-191957828 CTGTGTCTCTTTAGCTAGGATGG + Intronic
944265004 2:197714216-197714238 CTGTGGCATTTTAGCTAACAGGG - Intronic
945854584 2:215053541-215053563 CTGTGGGTCTTTGGCTGAGTAGG - Intronic
946529326 2:220554734-220554756 CTTTGGTCTGTTAGCTAAGAGGG + Intergenic
1172297027 20:33819635-33819657 TTGTGGTTGTTTAGCTCAAAAGG + Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1175933639 20:62505166-62505188 CTGTGGTTCTTGAGCTCTGGAGG - Intergenic
1177071095 21:16509574-16509596 CTGTGGTTAATTAGCTCAGTTGG + Intergenic
1178426030 21:32478987-32479009 CTGTGTTTATTTAGATAATAAGG - Intronic
1179008218 21:37532871-37532893 ATGTGAATCTTTAACTAAGATGG - Intergenic
1179276696 21:39898350-39898372 CTATGTTACTTTAGCTCAGATGG - Intronic
1183904516 22:41030413-41030435 CTGTGTTGCTTTAGTGAAGATGG + Intergenic
1183985150 22:41565693-41565715 CTGTGGTTCATCTGCCAAGAAGG + Intronic
1184194654 22:42918888-42918910 ATGTGTTTCTTCAGCTGAGAGGG - Intronic
1184721728 22:46318571-46318593 GGGTGGTTCTTTGGCAAAGATGG + Intronic
950508010 3:13407670-13407692 CTGTGTTTGGTGAGCTAAGAAGG - Intronic
950551184 3:13666771-13666793 TTGTGGTCCTATAGCCAAGAGGG - Intergenic
953201038 3:40778956-40778978 CTTTGGTTCTTTAGACCAGAGGG + Intergenic
953256936 3:41299668-41299690 CTGTGATCCTTTTGCTAAGGAGG + Intronic
955792431 3:62602458-62602480 CCGTGGTCCTGTTGCTAAGAAGG + Intronic
956206806 3:66763138-66763160 CTGTAAGTCTTTAGCTAACAGGG + Intergenic
956986360 3:74705851-74705873 TTGTTGTTCTTTTGTTAAGATGG - Intergenic
957063288 3:75499656-75499678 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
957212987 3:77284928-77284950 GTGTAATTATTTAGCTAAGAGGG + Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
959138855 3:102459517-102459539 CTGTAGTTCTGTTGCTAACAAGG + Intronic
960642459 3:119839898-119839920 CTGTGGTGATGTAGCTTAGATGG + Intronic
961896990 3:130176107-130176129 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
964227276 3:154419815-154419837 ATGTGTTTCCCTAGCTAAGAGGG - Intronic
967207384 3:187136519-187136541 CTGTGGTTCTTTAACTGCCAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969007171 4:4029661-4029683 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
969746443 4:9076400-9076422 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
969805791 4:9607795-9607817 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
970684904 4:18555902-18555924 CTGTGGTTCGTTAGGAAAGTGGG + Intergenic
970974430 4:22026942-22026964 CTGTGGTTCTATGGTTAAAATGG - Intergenic
971571247 4:28213651-28213673 TTGTGGTTGTTTTGCTGAGAAGG + Intergenic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
974994542 4:69138279-69138301 ATGTGGTGCTTTACCTATGATGG + Intronic
976194884 4:82522942-82522964 CTGGGGTTTTTTTGCTAAAACGG + Intronic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
981306474 4:143251798-143251820 ATGTGTTTCTTTTACTAAGAAGG + Intergenic
982420603 4:155192251-155192273 CTGTGGTTTTATATTTAAGAAGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
990707669 5:58548208-58548230 CTGTGCTTCTATTGCTAAAAGGG + Intronic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
992878965 5:81086457-81086479 CTGTGTTACTTTAGCTTATATGG + Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
994606744 5:101977138-101977160 GTGTGTTTGTTAAGCTAAGAGGG - Intergenic
994929088 5:106156873-106156895 GAGTGGTTCTTTTTCTAAGATGG - Intergenic
995525903 5:113050402-113050424 CTGTGGTTTATTACCTCAGAAGG - Intronic
995598932 5:113775512-113775534 CTGTGGTACTTGAGCCAGGAGGG + Intergenic
998245027 5:140493063-140493085 CTGTGGTTCTTTCTTTGAGACGG + Intronic
1003062426 6:2874190-2874212 CTGTAGTCATTTAACTAAGAAGG + Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1007867245 6:44985844-44985866 CTCTTGATCATTAGCTAAGAGGG - Intronic
1007992524 6:46271532-46271554 CTGTGGTTGGGTAGCTGAGATGG - Intronic
1008744006 6:54646727-54646749 CTGTGGTTCTTTTCTCAAGATGG - Intergenic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1010773646 6:79861168-79861190 ATGTGTTGCTTTAGATAAGAAGG - Intergenic
1011105596 6:83776682-83776704 CTTTGCTTCTTTATCAAAGATGG - Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1011868767 6:91865954-91865976 CTGTGTATCTGTAGCTAAGCTGG + Intergenic
1013598139 6:111679567-111679589 CTGTGGTTATTCAGCCAAAAAGG - Intronic
1014567365 6:122966287-122966309 CTGTGTTTCTTTAGAAAAGTTGG + Intergenic
1020327672 7:6987779-6987801 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1020330843 7:7015583-7015605 CTGTTGTTATCTGGCTAAGATGG + Intergenic
1021954041 7:25806019-25806041 CTGTAGTTGTTTAGCAGAGACGG - Intergenic
1024087945 7:45912174-45912196 CTTGGGTTCTTTTGCTAAAAGGG + Intergenic
1027596384 7:80179406-80179428 CAGTGGTTCTGAAGCTATGATGG - Intronic
1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG + Intronic
1030090922 7:105857874-105857896 CTGTGATTCTTAAGCTAAGGAGG - Intronic
1030319274 7:108146924-108146946 CTGGGGCTCTTTAGCAAAAAGGG - Intergenic
1036368942 8:8146318-8146340 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
1036881950 8:12519324-12519346 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1037164457 8:15810249-15810271 CAGGGGTTCTTTAGCTACAAAGG - Intergenic
1040883746 8:52236658-52236680 CTGTGTAGCTCTAGCTAAGATGG + Intronic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1045736766 8:105305197-105305219 CTTTGGTTCTGTTGCTAAAAAGG + Intronic
1048771821 8:137903421-137903443 ACGTGGTTCTTTATCTATGATGG + Intergenic
1048822653 8:138394087-138394109 CTGTGGTCCTTCAGCAAAGTTGG + Intronic
1050087167 9:1978144-1978166 CTGTGGTTCTGTGGCAAAGGTGG - Intergenic
1050283597 9:4078258-4078280 CAGTGGTGCTTTGGCTAAAATGG + Intronic
1053801302 9:41766055-41766077 CTGTGGCTCTGTAGCTACGCAGG + Intergenic
1054189732 9:61978209-61978231 CTGTGGCTCTGTAGCTACGCAGG + Intergenic
1054648783 9:67610383-67610405 CTGTGGCTCTGTAGCTACGCAGG - Intergenic
1059000801 9:110346886-110346908 ATGTGATTCTATAGATAAGAGGG + Intergenic
1059909297 9:119024679-119024701 CTGTGGTTCAGTGACTAAGAGGG - Intergenic
1060963813 9:127700458-127700480 CTGGGGTTCCTTAGCCAAGGGGG - Intronic
1185775448 X:2799485-2799507 CTGTGTTTTTTTACATAAGATGG + Intronic
1193280386 X:79641763-79641785 CTGTCTTACTTTGGCTAAGAAGG + Intergenic
1193572346 X:83160216-83160238 CTGTGGTGCTGTGGCTCAGACGG + Intergenic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1201426930 Y:13861797-13861819 AAGTGGCTCATTAGCTAAGATGG - Intergenic