ID: 993680199

View in Genome Browser
Species Human (GRCh38)
Location 5:90868351-90868373
Sequence CAGCAGCCTTTCATTAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993680199_993680204 26 Left 993680199 5:90868351-90868373 CCCTCATTAATGAAAGGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 993680204 5:90868400-90868422 CTTTTTTCTAAGAAAGGGAAAGG 0: 1
1: 0
2: 5
3: 56
4: 579
993680199_993680203 21 Left 993680199 5:90868351-90868373 CCCTCATTAATGAAAGGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 993680203 5:90868395-90868417 TATTTCTTTTTTCTAAGAAAGGG 0: 2
1: 0
2: 27
3: 608
4: 6926
993680199_993680202 20 Left 993680199 5:90868351-90868373 CCCTCATTAATGAAAGGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 183
Right 993680202 5:90868394-90868416 TTATTTCTTTTTTCTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993680199 Original CRISPR CAGCAGCCTTTCATTAATGA GGG (reversed) Intronic
901437648 1:9257797-9257819 CAGAAGCCTTTGAGAAATGATGG + Intronic
905009234 1:34735945-34735967 CAGCAGCCTTCCCTTGATGCAGG + Intronic
905985791 1:42280614-42280636 CTGCAGTTTTTCATTACTGAAGG - Intronic
907258830 1:53200768-53200790 CAGAAGCCTCTCTTGAATGATGG + Exonic
911315508 1:96352141-96352163 AAGCATCCTTTATTTAATGATGG + Intergenic
912979165 1:114355093-114355115 AATCAGCCTTTCAGTCATGATGG + Intergenic
915822571 1:159041000-159041022 CTGCAGCCTTTCAGTGATGGAGG + Intronic
915878170 1:159635320-159635342 CAGGAGTCTTTCATTTAGGACGG - Intergenic
916064303 1:161123741-161123763 CAGCATCCTTTCATTTAAGCTGG + Intronic
918269310 1:182881307-182881329 CCAGAGCCTTTCATCAATGAAGG + Exonic
920271007 1:204763785-204763807 CAGCACCCTAGCATTAATTAAGG - Intergenic
921668063 1:217896151-217896173 CTGCATCCTTTCAATAATGTGGG + Intergenic
923481733 1:234391550-234391572 CAGCAGCAGTTCACTAAGGAAGG + Exonic
924687522 1:246310342-246310364 CAGCAGCCATTCAATCCTGATGG + Intronic
1063119987 10:3098755-3098777 CAGCACCGTGTCATTAATGGAGG + Intronic
1063136416 10:3220732-3220754 AATCAGTCTTTCATTAATAATGG + Intergenic
1063286537 10:4694659-4694681 CAGCACCCAGTCATTCATGAGGG - Intergenic
1065062230 10:21914679-21914701 CAACAGCCTTTTTTTAAAGAGGG - Intronic
1068112806 10:52700276-52700298 CAGGACCCTTTCAATGATGATGG - Intergenic
1068694401 10:59950410-59950432 AAGCAGCCTTTGACTAAAGAAGG - Intergenic
1069492344 10:68871842-68871864 CAGCATCTTATCTTTAATGAGGG + Intronic
1069818042 10:71211100-71211122 CAGCAGCCTTTCTCAATTGATGG + Intergenic
1070246016 10:74731685-74731707 CAGGAAGCTTTCATTCATGATGG - Intergenic
1071121460 10:82283598-82283620 CAACAGGTTTTCAATAATGAAGG + Intronic
1074719147 10:116249543-116249565 CAGGAGTCTTTCTTTCATGAAGG - Intronic
1074847525 10:117411435-117411457 CAACATCCTTTCTTTAATGAGGG - Intergenic
1075126528 10:119704729-119704751 CAGGAGCTTCTCACTAATGATGG - Intergenic
1076076275 10:127536225-127536247 CAGCAGCCTCTCATTTGTGCAGG + Intergenic
1076176394 10:128371385-128371407 CAACAGCATTCCATTGATGATGG + Intergenic
1076791490 10:132779156-132779178 CAGCACACTTTCCTCAATGATGG - Intronic
1077195646 11:1278731-1278753 CATCAGCCTTTCGGCAATGACGG + Intronic
1078428636 11:11270573-11270595 CTGCAGCCCTTCATTCCTGAGGG - Intergenic
1082671985 11:56045447-56045469 ATCCTGCCTTTCATTAATGAAGG - Intergenic
1084992612 11:72942125-72942147 CAGCAGCAAGTCATTCATGAGGG - Intronic
1085286293 11:75363842-75363864 CAGCAGTCTTTTTGTAATGATGG + Intergenic
1087890154 11:103528780-103528802 CAACAGGCTTTGATTAATGCAGG - Intergenic
1088779456 11:113120415-113120437 CAACAGCCTAGCCTTAATGAAGG + Intronic
1088959669 11:114650515-114650537 CAACAGCCTTACATCAATGGAGG + Intergenic
1091092453 11:132784673-132784695 CAGCAACAATTCATTCATGAGGG - Intronic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1094084723 12:26576894-26576916 CAGCATCAATTCATTTATGAGGG - Intronic
1094213130 12:27913393-27913415 CATCAGCCCTTCAGTCATGAAGG + Intergenic
1097349078 12:58527797-58527819 TAGCATCCTTTCATCAAGGAAGG + Intergenic
1097379355 12:58876615-58876637 CAGCAGCATTTTATTAACCAAGG + Intronic
1098922115 12:76312395-76312417 CATAAGCCTTTCAGTAATGCCGG + Intergenic
1099363386 12:81736091-81736113 CAGCAGCCTTTTATACAGGAAGG - Intronic
1099981267 12:89606242-89606264 CTACTGACTTTCATTAATGAAGG - Intronic
1099994529 12:89763939-89763961 CAGCAGCAATGCATTCATGATGG - Intergenic
1100737227 12:97549844-97549866 AAGCAGGTGTTCATTAATGAAGG + Intergenic
1101002548 12:100371229-100371251 CATCTTCCTTTCATAAATGAGGG + Intronic
1103930459 12:124448123-124448145 CAGCAGGCTCTCAATAAAGATGG + Intronic
1105433566 13:20358587-20358609 CAGTAGCCTTTAATAACTGAGGG - Intergenic
1107862860 13:44677322-44677344 CTGCAACCTTCCATTAAGGAAGG - Intergenic
1108677055 13:52746160-52746182 CAGCAGACTTTCTCTAATGAGGG + Intergenic
1109796708 13:67324219-67324241 CAGCAGCCGCACATTAAGGAAGG + Intergenic
1111788306 13:92819436-92819458 CAGCTTCATTTTATTAATGAGGG - Intronic
1115667056 14:35562464-35562486 CAGACGTCATTCATTAATGAGGG - Intronic
1115885006 14:37961507-37961529 CAGCAGCATTTCCATTATGATGG - Intronic
1120969045 14:90192217-90192239 CAGGAAGCTTTCATTCATGATGG + Intergenic
1124958732 15:34378172-34378194 CACCTGCTTTTCAGTAATGAAGG - Intergenic
1125814031 15:42568437-42568459 CAGCACTAATTCATTAATGAGGG + Exonic
1126881806 15:53106915-53106937 CAGCAGCCTTCCATAACTAAGGG - Intergenic
1127288728 15:57552193-57552215 CTCCAGCCTTTCTTTATTGACGG - Intergenic
1127473581 15:59311785-59311807 CAGCATCCATTTATTTATGAGGG - Intronic
1129376559 15:75137425-75137447 CTGCAGCCCTTCACTAATCATGG - Intergenic
1130011386 15:80155259-80155281 CAGCAGCCTTTGTGTAATGCTGG + Intronic
1133558586 16:6928627-6928649 TAGCAGCCTTGCATTCATGTGGG + Intronic
1135157914 16:20070052-20070074 CAACTGCCTGGCATTAATGAAGG + Intronic
1135887910 16:26329116-26329138 CAGCTGCCTTCCATCAGTGAGGG + Intergenic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1140767346 16:78172770-78172792 ATGCATCCTTTCATTAATGTGGG + Intronic
1141814243 16:86398818-86398840 CAGCTGCCTTCCATTCATAAGGG + Intergenic
1141887537 16:86902778-86902800 CTGCATCCTTGCATTAATGCGGG + Intergenic
1148689037 17:49516167-49516189 CACCAGCCTTACATTCTTGAGGG + Intergenic
1148789191 17:50163964-50163986 CTGCAGCTTTTCATTAAGGAAGG + Intergenic
1149253811 17:54801332-54801354 CAGCAGAATTCCAGTAATGATGG + Intergenic
1151185383 17:72360446-72360468 CAGCAGCCTTGCAGTGAGGAGGG - Intergenic
1151344500 17:73493318-73493340 CGGGAGCCTTTCATTAAAGGCGG + Intronic
1152439162 17:80294938-80294960 CAACAGCCTATGATTTATGAAGG + Exonic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1155865050 18:30954602-30954624 CAGTAGCCTTTGATGAATGGAGG - Intergenic
1156341966 18:36217884-36217906 CTGCAGCCTTTCCTCAATGTGGG + Intronic
1157380126 18:47206692-47206714 TAGCAGCCATTCATTAGTGGGGG - Intergenic
1161676826 19:5655596-5655618 CAGCAGCCCCTCCTTAAGGAAGG + Intronic
1168122790 19:54262228-54262250 CAGCATCCTTTCACTGCTGAGGG + Intronic
925351683 2:3205425-3205447 CAGCTGCCTTGCAGTCATGAAGG + Intronic
932686292 2:73873272-73873294 CAGCTGCCATTCTTTATTGATGG + Intronic
933033819 2:77366945-77366967 CAGAAGGAGTTCATTAATGAAGG - Intronic
937901653 2:127024677-127024699 CAGCAGCTGGTCAATAATGAAGG + Intergenic
938714807 2:134009742-134009764 CAGCAGCATTTGTGTAATGAAGG - Intergenic
938789122 2:134661007-134661029 CAGCATCAATCCATTAATGAGGG - Intronic
946378700 2:219330302-219330324 CAGCAGAGTTTCATGAATGTTGG - Intronic
948511923 2:238473677-238473699 AAGCTGTCTTTCAGTAATGAAGG - Intergenic
1170453188 20:16507282-16507304 AGGCAGCATTTTATTAATGAGGG - Intronic
1170624224 20:18019209-18019231 CAGCAGCCTTCAACCAATGATGG + Intronic
1171242612 20:23584251-23584273 CAGCAGCCTCTCAGGACTGATGG - Intergenic
1173841746 20:46161862-46161884 TAGCATCCTTTCATCGATGATGG + Intergenic
1174150851 20:48485312-48485334 CAGCAGCCTGTGTTTAAAGATGG + Intergenic
1174372419 20:50100650-50100672 CAGCTTCCATTCAGTAATGAAGG - Intronic
1175040845 20:56049463-56049485 CAGCAGCCTCTGCTTATTGATGG - Intergenic
1178416117 21:32406569-32406591 TAGCACACTTTCCTTAATGATGG + Intergenic
1180242945 21:46524020-46524042 CAGCCGCTTGTCAGTAATGAAGG + Intronic
949127054 3:458683-458705 GAGTAGCTTTGCATTAATGATGG + Intergenic
952978331 3:38715096-38715118 CTGGAGCCTTGCATGAATGAAGG - Intronic
953659642 3:44882815-44882837 CATCTGCCTAACATTAATGATGG + Intronic
954624674 3:52016040-52016062 CAGCAGCCGCTCAGTAATTAGGG + Intergenic
954748499 3:52800541-52800563 CAGCAGCCCGTCATTGATGTTGG - Exonic
955261813 3:57398700-57398722 CAGCTGCCTTACAAAAATGAAGG + Intronic
955908899 3:63839332-63839354 CAGCAGCCTTTTATTAGCAAAGG + Intronic
956381723 3:68671160-68671182 CACCATCCTTGCATAAATGAAGG + Intergenic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
957538029 3:81531530-81531552 CAGGATTCTTTAATTAATGACGG - Intronic
957835117 3:85577327-85577349 CAGCATTCATTCATTCATGAGGG - Intronic
960598243 3:119427876-119427898 AAGCTGTCTTTCATAAATGAGGG - Intergenic
960967585 3:123115988-123116010 CAGCAGCCACTCATAAATGTTGG - Intronic
961195359 3:124996882-124996904 CAGCAGCCTTTTATAAGTCAGGG + Intronic
961391749 3:126556259-126556281 CAGCAGCCCCTCACCAATGAGGG + Intronic
965286339 3:166824732-166824754 CAGCAGTTTTTCACTAAGGAGGG + Intergenic
968709176 4:2100444-2100466 CACCAGACTTTCATTAAGGAAGG + Intronic
970566502 4:17336926-17336948 TTGCAGCATTTCATAAATGAAGG + Intergenic
971213971 4:24646658-24646680 CAGGAGCCCATCATTTATGAAGG - Intergenic
971890547 4:32515386-32515408 CAGAAAACTTTCAATAATGAGGG - Intergenic
972319655 4:37961826-37961848 CAGCATCCTTTGATTGAAGAGGG - Intronic
973845084 4:54903513-54903535 CAGCAGCCATTCTTTATTCAGGG - Intergenic
973982436 4:56317293-56317315 CACCAGCCTCTAATTAATGAAGG - Intronic
974773497 4:66447839-66447861 CATCAGCCTTGCATTAAATAAGG - Intergenic
976067244 4:81202101-81202123 CATCATCCTTTCATCAGTGAAGG + Intronic
977877192 4:102163790-102163812 CAGCATCCATGCATTCATGAGGG - Intergenic
980867168 4:138565574-138565596 GAGCAGCCTTTCCAAAATGAGGG - Intergenic
980936377 4:139229418-139229440 CACCAGCCTCTCCTTAAAGAGGG - Intergenic
981010488 4:139920632-139920654 CAACCACCTTTCATTAATGGAGG + Intronic
983913940 4:173270468-173270490 CAGCCTCCTTTCTTTTATGAAGG + Intronic
984454000 4:179941864-179941886 CAGAAGCCTTTCATGAAAGGAGG - Intergenic
985589567 5:757537-757559 CAGCAGCCCTTCCCTGATGAGGG + Intronic
988366915 5:30311367-30311389 CAGGAAACTTTCAGTAATGATGG - Intergenic
990284077 5:54282406-54282428 CAGCAGATTTTCTTTAAAGAGGG - Intronic
992257529 5:74935819-74935841 ATGCAGCATTTAATTAATGAGGG - Intergenic
993680199 5:90868351-90868373 CAGCAGCCTTTCATTAATGAGGG - Intronic
996231904 5:121074922-121074944 TACCATCCTTTCATGAATGATGG - Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
998026956 5:138825578-138825600 CAGCATCCTTTCATAAAGTAGGG + Intronic
998219664 5:140266318-140266340 CAGCAGCCTATCATTAAACTAGG + Intronic
1000091088 5:157930201-157930223 CAGCATTAATTCATTAATGAGGG + Intergenic
1000230695 5:159312462-159312484 CAGCAGCCTCTCATAGATGGGGG + Intergenic
1000453566 5:161420645-161420667 CTGCAGCCTTCCATTTCTGAAGG - Intronic
1001349846 5:170950003-170950025 CAGCACCATTTTATTAAAGAGGG - Intronic
1007284973 6:40741109-40741131 CAGCAGCCCTCCATTGCTGATGG + Intergenic
1008269813 6:49477812-49477834 TAGCAGCCTATTATTAAAGAAGG + Intronic
1009573730 6:65424542-65424564 CAGATGCCTTTCATTAAACATGG - Intronic
1010410652 6:75557710-75557732 CAGCATCCGTTCATTCATGATGG - Intergenic
1011967655 6:93179093-93179115 CAGCAGCCTTTTATAAAACAGGG + Intergenic
1013469907 6:110454036-110454058 CAGCACCAATTCATTCATGAGGG + Intronic
1014186949 6:118445686-118445708 GAGCTGCCTTTCCTGAATGAGGG + Intergenic
1015657566 6:135536577-135536599 CAGCAATTTTCCATTAATGAGGG - Intergenic
1016317793 6:142808966-142808988 CAGGAGCCTTTCATTTAATAAGG - Intronic
1017828856 6:158106148-158106170 CTTCTGCCTTCCATTAATGAAGG + Intergenic
1019566858 7:1687197-1687219 AAGCAGTTTTTCATGAATGAAGG + Intergenic
1022935524 7:35171553-35171575 CAGTTGCTTTTCATTACTGAAGG - Intergenic
1023122676 7:36925442-36925464 TAGCATCCTTTCATAAATTAAGG - Intronic
1023684875 7:42723717-42723739 CAGCAGCCCTCCAGCAATGATGG + Intergenic
1024530221 7:50385154-50385176 CAGCAGCCCTGCATCCATGATGG - Intronic
1027828120 7:83142526-83142548 CAGCAGATGTTCATTGATGATGG - Intronic
1028999189 7:97135166-97135188 AAGCAGCCTTACAATAATAAGGG - Intronic
1029163004 7:98566138-98566160 CAGCATTAATTCATTAATGAAGG - Intergenic
1030512596 7:110502429-110502451 CAGCACCCTGTTGTTAATGATGG - Intergenic
1030861089 7:114630433-114630455 CAGTAGCAGTTCATTAATCAGGG - Intronic
1031024593 7:116666612-116666634 GATCAGCATTTCATTAAGGATGG - Intergenic
1031065137 7:117096466-117096488 CAGCAGCCTTTCATTAGAAAAGG - Intronic
1033250291 7:139752854-139752876 CAGCAGCATTTGACTAATGTGGG - Intronic
1035720064 8:1784973-1784995 CAGCTGCCTTTCCTTCATGCTGG + Exonic
1035773868 8:2172299-2172321 CAGCAACATTACATTAATGCAGG - Intergenic
1035929297 8:3763355-3763377 CACCAGCCATTCATTCATGAGGG - Intronic
1036821873 8:11947143-11947165 CAGCAGCCCTCAACTAATGAGGG + Intergenic
1037186393 8:16068523-16068545 CAGTATCTTTGCATTAATGAAGG - Intergenic
1045950073 8:107841425-107841447 CAGAATCTTTTCTTTAATGAAGG - Intergenic
1048456413 8:134582387-134582409 CAGCTGCTCTTCATTACTGAAGG + Intronic
1048824242 8:138408407-138408429 CAGCAGAGGTTGATTAATGAGGG - Intronic
1049030186 8:140029950-140029972 AACCAGCCTTGCATTATTGATGG - Intronic
1050830507 9:10005634-10005656 AAGCTGCATTTGATTAATGAAGG - Intronic
1053225926 9:36357129-36357151 CAGCCTCCTTTCAGAAATGAGGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056854853 9:90117770-90117792 CTGCAGCATTTCATAAAGGAGGG - Intergenic
1058094714 9:100846591-100846613 CATCAGACTTTCCTTCATGAAGG - Intergenic
1059483217 9:114608302-114608324 TATCTGCCTTTCATAAATGAGGG + Intergenic
1186853610 X:13604426-13604448 GAGCAGCCTCCCATCAATGAAGG - Intronic
1187202460 X:17148348-17148370 CATCAGCCTTTCATATTTGATGG - Exonic
1188162902 X:26823929-26823951 CAGCAGCCATTAATTAATAACGG - Intergenic
1192708600 X:73555760-73555782 GAGCAGCACGTCATTAATGAGGG + Intergenic
1196195489 X:112834624-112834646 CAGCTGGATTTTATTAATGATGG - Intronic
1196291988 X:113952859-113952881 AAACAGCCTCTCATTATTGACGG - Intergenic
1197167107 X:123390360-123390382 AAGTTGCCTTTCATAAATGAAGG - Intronic
1198650695 X:138860777-138860799 CAGCAGCCTTTCAAAAAGCATGG - Intronic
1198849057 X:140945695-140945717 AGGCAGCCTTTGATTAATGTTGG + Intergenic