ID: 993685242

View in Genome Browser
Species Human (GRCh38)
Location 5:90929336-90929358
Sequence GCGTCGTGTTTTAAGCCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1209
Summary {0: 1, 1: 1, 2: 47, 3: 478, 4: 682}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993685238_993685242 8 Left 993685238 5:90929305-90929327 CCGAGCCAGGTGCGGGATATAAT 0: 636
1: 1265
2: 1149
3: 581
4: 360
Right 993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG 0: 1
1: 1
2: 47
3: 478
4: 682
993685236_993685242 12 Left 993685236 5:90929301-90929323 CCCTCCGAGCCAGGTGCGGGATA 0: 496
1: 1490
2: 1803
3: 1148
4: 796
Right 993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG 0: 1
1: 1
2: 47
3: 478
4: 682
993685239_993685242 3 Left 993685239 5:90929310-90929332 CCAGGTGCGGGATATAATCTTGT 0: 57
1: 385
2: 1010
3: 2052
4: 1452
Right 993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG 0: 1
1: 1
2: 47
3: 478
4: 682
993685232_993685242 26 Left 993685232 5:90929287-90929309 CCATGGGTGTAGGACCCTCCGAG 0: 154
1: 1208
2: 1622
3: 1113
4: 897
Right 993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG 0: 1
1: 1
2: 47
3: 478
4: 682
993685237_993685242 11 Left 993685237 5:90929302-90929324 CCTCCGAGCCAGGTGCGGGATAT 0: 494
1: 1487
2: 1828
3: 1188
4: 779
Right 993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG 0: 1
1: 1
2: 47
3: 478
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993685242 Original CRISPR GCGTCGTGTTTTAAGCCGGT CGG Intronic
904931688 1:34092696-34092718 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
904952108 1:34251042-34251064 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
906752424 1:48277491-48277513 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
906760155 1:48369605-48369627 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
906828419 1:49006314-49006336 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
906909698 1:49935145-49935167 GCGCCGTTTTTTAAGCCCATCGG - Intronic
907631765 1:56089947-56089969 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
907838287 1:58132162-58132184 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
907863745 1:58378884-58378906 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
907969763 1:59369224-59369246 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
908073603 1:60490432-60490454 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
908575578 1:65455986-65456008 GCGCCATTTTTTAAGCCCGTCGG + Intronic
908665082 1:66481225-66481247 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
908977088 1:69911026-69911048 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
909216610 1:72899069-72899091 GCGCCGTTTTTTAAGCTGGTTGG - Intergenic
909370422 1:74877425-74877447 GCGGCGTTTTTTAAGCCCGTCGG - Intergenic
909413006 1:75376124-75376146 GCGCCGTTTTTTAAGCCGGTCGG - Intronic
909441174 1:75697940-75697962 GCATGGTTTTTTAAGCCCGTTGG - Intergenic
909778841 1:79516960-79516982 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
909846460 1:80400174-80400196 GCGCCATTTTTTAAGCCCGTTGG + Intergenic
909983868 1:82136623-82136645 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
910068428 1:83182473-83182495 CCGCCGTTTTTTAAGCCTGTCGG - Intergenic
910074712 1:83263906-83263928 TCGCCGTTTTTTAAGCCTGTCGG - Intergenic
910082358 1:83356142-83356164 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
910157401 1:84234618-84234640 GCGCCGTTTTTTAAGCCCGTGGG + Intronic
910295611 1:85642163-85642185 GTGCCGTTTTTTAAGCCCGTAGG - Intergenic
910699956 1:90062991-90063013 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
910815389 1:91286948-91286970 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
911033022 1:93509899-93509921 GCGCCATTTTTTAAGCCTGTCGG - Intronic
911307300 1:96246802-96246824 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
911394395 1:97287758-97287780 GCGCCATTTTTTAAGCCTGTCGG + Intronic
911492620 1:98588951-98588973 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
911673957 1:100638066-100638088 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
911813433 1:102312626-102312648 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
911859923 1:102933794-102933816 GCGCCGTTTTTTAAGCCGGTCGG + Intronic
912009454 1:104940857-104940879 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
912447427 1:109748622-109748644 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
912737196 1:112160505-112160527 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
913054776 1:115148112-115148134 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
913186391 1:116373657-116373679 GCGTCGTCTTTTAAGCCGCGCGG - Intronic
913388090 1:118281182-118281204 GCGCCGTTTTTTAAGCCGGTTGG - Intergenic
913454934 1:119020933-119020955 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
914401746 1:147327491-147327513 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
914410594 1:147423519-147423541 GGGCCGTTTTTTAAGCTGGTCGG - Intergenic
915808965 1:158886404-158886426 GCGCCATTTTTTAAACCGGTCGG - Intergenic
916342881 1:163755943-163755965 GCGCCGTTTTTTAAGCCCGTGGG + Intergenic
916402036 1:164459503-164459525 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
916816122 1:168354564-168354586 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
916977336 1:170094878-170094900 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
917398078 1:174615907-174615929 GCGCCGTTTTTTAAGCCCGTTGG + Intronic
917549382 1:176008048-176008070 GCGCCGTTTTTTAAGCCGGTCGG + Intronic
917575184 1:176314085-176314107 GCGCCATTTTTTAAGCCGGTCGG + Intergenic
917684962 1:177406623-177406645 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
917705892 1:177634219-177634241 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
917842531 1:178993301-178993323 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
918351257 1:183658370-183658392 GCGCCGTTTTTTAAGCCTGTTGG - Intronic
918483215 1:185001831-185001853 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
918506276 1:185257485-185257507 GCGCCGTTTTTTAAGCCGGTCGG + Intronic
918548016 1:185707688-185707710 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
918563112 1:185893014-185893036 GCGCCGTTTTTTAAGCAGGTCGG + Intronic
918785507 1:188757938-188757960 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
918826520 1:189331105-189331127 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
918836667 1:189474448-189474470 GCGCCATTTTTTAAGCCCGTTGG + Intergenic
919375328 1:196786633-196786655 GTGCCGTTTTTTAAGCCCGTGGG + Intronic
919454165 1:197802631-197802653 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
920638756 1:207730766-207730788 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
920996361 1:210996300-210996322 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
921844458 1:219863867-219863889 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
922172552 1:223167915-223167937 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
923875537 1:238042947-238042969 GCGCTGTTTTTTAAGCCCGTTGG + Intergenic
924872847 1:248067807-248067829 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
924888930 1:248253153-248253175 GCGCCGTATTTTAAGCCCTTCGG - Intergenic
1062924210 10:1302316-1302338 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1063326608 10:5109921-5109943 GCGCCATTTTTTAAGCCTGTCGG - Intronic
1063333016 10:5180815-5180837 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1063897391 10:10696707-10696729 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1064922206 10:20531521-20531543 GGGCCGTTTTTTAAGCCTGTCGG + Intergenic
1065107868 10:22408840-22408862 GCTCCGTTTTTTAAGCCGATTGG + Intronic
1066145997 10:32558979-32559001 GCGCTGTTTTTTAAGCCTGTTGG - Intronic
1066444994 10:35474084-35474106 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
1066595409 10:37044584-37044606 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1066664174 10:37765924-37765946 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1066676898 10:37897271-37897293 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1066934043 10:41803581-41803603 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1066982892 10:42435682-42435704 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1066992774 10:42531899-42531921 GCTCAGTGTTTTAAGCCCGTCGG + Intergenic
1067301515 10:45014874-45014896 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1067335780 10:45362461-45362483 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1067987257 10:51163707-51163729 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1068115795 10:52736205-52736227 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1068256208 10:54515291-54515313 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1068355073 10:55899941-55899963 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1068394905 10:56447918-56447940 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1069110663 10:64442199-64442221 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1069148368 10:64924534-64924556 GCGCAGTTTTTTAAGCCCGTCGG - Intergenic
1069325872 10:67230962-67230984 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1069338889 10:67387346-67387368 GCGCCGTTTTTTAAGCCCCTAGG - Intronic
1070202120 10:74217181-74217203 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1070231643 10:74573835-74573857 GCGCCATTTTTTAAGCCTGTTGG + Intronic
1071077571 10:81772918-81772940 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1071127243 10:82349769-82349791 GTGCCGTTTTTTAAGCCAGTCGG + Intronic
1071248077 10:83786764-83786786 GTGCCGTGTTTTAAGCCAGTCGG + Intergenic
1071352668 10:84762562-84762584 GCACCGTTTTTTAAGCCGGTCGG + Intergenic
1071904623 10:90159157-90159179 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1071912408 10:90250915-90250937 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1072013975 10:91327681-91327703 GCGCCGTTTTTTAAGCCCATTGG + Intergenic
1072029354 10:91503565-91503587 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1072399178 10:95079517-95079539 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1072855049 10:98937398-98937420 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1073565704 10:104534055-104534077 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1073661481 10:105480853-105480875 GCGCCATTTTTTAAGCCTGTTGG + Intergenic
1073684342 10:105736012-105736034 GTGCTGTTTTTTAAGCCGGTCGG - Intergenic
1073987282 10:109223912-109223934 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1074303168 10:112251199-112251221 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1074652202 10:115536440-115536462 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1074809110 10:117084740-117084762 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1075184157 10:120240008-120240030 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1075254190 10:120911261-120911283 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1075973747 10:126676773-126676795 GCTCCGTTTTTTAAGCCCGTTGG - Intergenic
1076339941 10:129738258-129738280 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1076938246 10:133580857-133580879 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1077643149 11:3900263-3900285 GCGCTGTTTTTTAAGCCCGTGGG + Intronic
1077673244 11:4175950-4175972 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1077950784 11:6954563-6954585 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1078021939 11:7663852-7663874 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1078040836 11:7861335-7861357 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1078242821 11:9546042-9546064 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1078304788 11:10173448-10173470 GCGGCGTTTTTTAAGCCTGTCGG - Intronic
1078689026 11:13560664-13560686 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1078800014 11:14633842-14633864 GCGCCGTTTTTTAAGTCCGTCGG + Intronic
1078802544 11:14661619-14661641 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1078817814 11:14844648-14844670 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1079286202 11:19135360-19135382 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1079549341 11:21674746-21674768 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1079618880 11:22528892-22528914 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1079629173 11:22652625-22652647 GTGCTGTGTTTTAAGCCCGTGGG + Intronic
1079842789 11:25425434-25425456 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1079848692 11:25501816-25501838 GCGCTGTTTTTTAAGCCTGTGGG + Intergenic
1079859556 11:25649475-25649497 GCGCCGTTTTTTAAGCCTGTGGG + Intergenic
1079922630 11:26451397-26451419 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1080093653 11:28378359-28378381 GCATCGCTTTTTAAGCCTGTCGG + Intergenic
1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
1080579455 11:33630484-33630506 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1080705915 11:34692519-34692541 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1080810902 11:35703069-35703091 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1081039376 11:38192043-38192065 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1081086773 11:38811479-38811501 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1081161480 11:39755342-39755364 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1081169244 11:39846956-39846978 GCGCCATTTTTTAAGCCGGTGGG - Intergenic
1081697765 11:45128174-45128196 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1082117816 11:48346281-48346303 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1082586443 11:54947266-54947288 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1082970492 11:59015539-59015561 GCACCGTTTTTTAAGCCTGTTGG - Intronic
1083113521 11:60435719-60435741 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1083532356 11:63435604-63435626 GCGCCGTTTTTTAAGCCAGTCGG - Intergenic
1085222082 11:74883215-74883237 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1085343419 11:75748914-75748936 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
1085797187 11:79552954-79552976 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1086175270 11:83884255-83884277 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1086441077 11:86830320-86830342 GCATCGTTTTTTAAGCCTGTCGG + Intronic
1086481779 11:87247684-87247706 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1086628404 11:88987297-88987319 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1086686979 11:89744487-89744509 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1086718875 11:90095408-90095430 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1086870081 11:92027188-92027210 TCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1087228607 11:95632028-95632050 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1087824298 11:102747143-102747165 GCGCTGTTTTTTAATCCGGTTGG + Intergenic
1087909744 11:103739192-103739214 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1088012143 11:105016596-105016618 GCGCCATTTTTTAAGCCGGTTGG - Intronic
1088473255 11:110209276-110209298 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1088957619 11:114625963-114625985 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1089101625 11:115967236-115967258 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1089816228 11:121178007-121178029 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
1090509867 11:127363463-127363485 GGGCCGTTTTTTAAGCCCGTCGG - Intergenic
1090706739 11:129344619-129344641 GTGCCGTTTTTTAAGCCCGTAGG + Intergenic
1090896803 11:130984564-130984586 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1091045249 11:132319435-132319457 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1091045418 11:132320464-132320486 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1091185264 11:133641102-133641124 GCGCCGTTTTTTAAACCCGTCGG - Intergenic
1091810995 12:3397915-3397937 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1092301153 12:7251430-7251452 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
1092553293 12:9527252-9527274 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1093404246 12:18785514-18785536 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1093571219 12:20668136-20668158 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1093609602 12:21137662-21137684 GTGCTGTTTTTTAAGCCGGTTGG + Intronic
1093615262 12:21214767-21214789 GCGCCGTTTTTTAAGCCCCTCGG + Intronic
1093629825 12:21395310-21395332 GCGCCGTTTTTTAAGCCTGTTGG - Exonic
1093693688 12:22136832-22136854 GCGTCGTTTTTTAAGCCTGTCGG - Intronic
1094092797 12:26669860-26669882 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1094282929 12:28760528-28760550 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1094341100 12:29412135-29412157 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1094377815 12:29810027-29810049 GCGCCGTTTTTTAAGCTCGTCGG - Intergenic
1094451626 12:30588656-30588678 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1094518812 12:31163374-31163396 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1094735326 12:33227865-33227887 GCGCCGATTTTTAAGCCCGTCGG - Intergenic
1094785977 12:33848430-33848452 GCGCCGTATTTTAAGCCTGTTGG - Intergenic
1094877985 12:34672778-34672800 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1095151000 12:38796858-38796880 GCGCCATTTTTTAAGCCCGTCGG - Intronic
1095340875 12:41087162-41087184 GTGTGGTTTTTTAAGCCCGTCGG + Intergenic
1095387885 12:41672009-41672031 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1095423433 12:42049319-42049341 GTGCCGTTTTTTAAGCCCGTAGG + Intergenic
1095534337 12:43228028-43228050 GCGCCGTTTTTTAAGCCCGTGGG - Intergenic
1095591280 12:43906783-43906805 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1095677011 12:44932000-44932022 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1095873634 12:47057021-47057043 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1096433834 12:51571476-51571498 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1096901612 12:54888710-54888732 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1096921135 12:55087085-55087107 GCGCCGTTTTTTAAGCCGGTTGG + Intergenic
1096931066 12:55210727-55210749 GCACCGTTTTTTAAGCCTGTCGG - Intergenic
1096962117 12:55590237-55590259 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1097409100 12:59228153-59228175 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1097578202 12:61420802-61420824 GGGCCGTTTTTTAAGCCCGTTGG + Intergenic
1098387973 12:69938980-69939002 GCGCCATTTTTTAAGCCCGTCGG - Intronic
1098615773 12:72520345-72520367 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1098665242 12:73153322-73153344 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1098668897 12:73199467-73199489 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1098767571 12:74509219-74509241 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1099040963 12:77654266-77654288 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1099146141 12:79045325-79045347 GCGCCATTTTTTAAGCCGGTCGG + Intronic
1099242040 12:80149772-80149794 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1099266557 12:80454198-80454220 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1099267109 12:80462176-80462198 GTGCCGTTTTTTAAGCCTGTCGG - Intronic
1099514793 12:83584568-83584590 GCACCGTTTTTTAAGCCTGTCGG - Intergenic
1099548228 12:84011607-84011629 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1099643232 12:85318138-85318160 GCGCCGTTTTTTAAGCCCTTCGG + Intergenic
1099901329 12:88714563-88714585 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1099999131 12:89812280-89812302 GCGCCGTTTTTTAAGCCCATAGG + Intergenic
1100919242 12:99463602-99463624 GCACCGTTTTTTAAGCCTGTCGG - Intronic
1101189184 12:102313446-102313468 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1101495069 12:105246102-105246124 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1101552587 12:105776368-105776390 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1102750104 12:115285424-115285446 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1104251641 12:127100309-127100331 GCGCCGTTTTTTAAACCCGTCGG + Intergenic
1105316849 13:19273295-19273317 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1105667342 13:22575034-22575056 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1105906153 13:24812346-24812368 GCGCCATTTTTTAAGCCGGTCGG + Intronic
1107162731 13:37250647-37250669 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1107208851 13:37827976-37827998 GGGCCGTTTTTTAAGCCCGTCGG + Intronic
1107227199 13:38065675-38065697 GCACCGTTTTTTAAGCCCGTTGG - Intergenic
1107475903 13:40735221-40735243 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
1107489794 13:40870275-40870297 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1107973765 13:45669897-45669919 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1108296105 13:49019306-49019328 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1108308028 13:49158225-49158247 GCGCCGTTTTTTAAGCCGGTCGG + Intronic
1108491072 13:50982355-50982377 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1108502420 13:51080525-51080547 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1108628302 13:52254616-52254638 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1108657758 13:52551833-52551855 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1108837718 13:54572540-54572562 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1109312297 13:60710054-60710076 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1109823344 13:67685969-67685991 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1110086842 13:71390393-71390415 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1110275830 13:73640816-73640838 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1110328191 13:74241654-74241676 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1110353293 13:74536750-74536772 GCGCCGTTTTTTAAGCCCTTTGG - Intergenic
1110459880 13:75733455-75733477 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1110812171 13:79822896-79822918 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1110813837 13:79839963-79839985 GCGCCGTTTTTTAATCCCGTTGG - Intergenic
1110991245 13:82045651-82045673 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1111004357 13:82229312-82229334 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1111616192 13:90664284-90664306 GCACCGTGTTTTAAGCCCATCGG - Intergenic
1111782970 13:92752777-92752799 GCGCTGTTTTTTAAGCCCGTTGG - Intronic
1111917110 13:94372501-94372523 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1112061052 13:95740515-95740537 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1112229026 13:97569127-97569149 GCCTGGTGTTTTAAGCAGGAAGG - Intergenic
1112245626 13:97730713-97730735 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1113206839 13:107926384-107926406 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1115168284 14:30474341-30474363 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1115278998 14:31639914-31639936 GCGCCGTTTTTTAAGCCCGTTGG + Intronic
1115335412 14:32240431-32240453 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1115719856 14:36148367-36148389 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1115723153 14:36184851-36184873 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1115868288 14:37772508-37772530 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1115943567 14:38635247-38635269 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1115977933 14:39017480-39017502 GTGTCGTTTTTTAAGCCCGTTGG - Intergenic
1116027009 14:39527135-39527157 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1116209232 14:41911432-41911454 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1116284940 14:42958935-42958957 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1116322810 14:43492477-43492499 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1116331061 14:43598201-43598223 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1116339053 14:43698944-43698966 GTGCCGTTTTTTAAGCCGGTGGG - Intergenic
1116495152 14:45551567-45551589 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1116618682 14:47171958-47171980 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1116675493 14:47901481-47901503 GCGCGGTTTTTTAAGCCCGTCGG - Intergenic
1116768142 14:49097004-49097026 GCGCCGTTTTTTAAGCCGGTTGG - Intergenic
1117280317 14:54234180-54234202 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1117452122 14:55861925-55861947 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
1117598042 14:57343794-57343816 GGGCCGTTTTTTAAGCCCGTCGG + Intergenic
1118955240 14:70475504-70475526 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1119111814 14:71981990-71982012 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1119985428 14:79131882-79131904 GTGCCGTTTTTTAAGCCTGTCGG + Intronic
1120042327 14:79768060-79768082 GCGCCATTTTTTAAGCCCGTCGG - Intronic
1120069665 14:80088829-80088851 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1120157919 14:81114467-81114489 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1120233054 14:81860104-81860126 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1120371280 14:83639599-83639621 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1120567716 14:86080198-86080220 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1120569694 14:86101725-86101747 GCGCCGTTTTTTAAGCCCTTTGG + Intergenic
1120585945 14:86312527-86312549 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1120675746 14:87419389-87419411 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1121376787 14:93418851-93418873 GCGCCATTTTTTAAGCCCGTTGG + Intronic
1123444054 15:20311330-20311352 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1123790444 15:23714370-23714392 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1124152456 15:27193548-27193570 GCGCCGTTTTTTAAGCCCTTGGG + Intronic
1124502945 15:30246075-30246097 GCGCCGTTTTTTAAGCCCGTAGG + Intergenic
1124513431 15:30347039-30347061 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1124670263 15:31632948-31632970 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1124729491 15:32183726-32183748 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1124740612 15:32292571-32292593 GCGCCGTTTTTTAAGCCCGTAGG - Intergenic
1125123726 15:36195670-36195692 GCGCCATGTTTTAAGCCCGTCGG - Intergenic
1125226818 15:37405154-37405176 GAGCGGTTTTTTAAGCCGGTCGG + Intergenic
1125358425 15:38840769-38840791 GCGCTGTTTTTTAAGCCTGTCGG + Intergenic
1125937661 15:43650258-43650280 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
1126298207 15:47165834-47165856 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1126493516 15:49265400-49265422 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1126501818 15:49354534-49354556 GCGCCGTTTTTTAAGCCGGTCGG - Intronic
1126537685 15:49784196-49784218 GCGCCGTTTTTTAAGCCCCTCGG + Intergenic
1126661439 15:51037330-51037352 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1126933833 15:53684497-53684519 GCGCCGCTTTTTAAGCCCGTCGG - Intronic
1127031744 15:54871998-54872020 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1127157205 15:56140320-56140342 GCGCCGCTTTTTAAGCCCGTCGG + Intronic
1127172451 15:56316854-56316876 GCATCGTTTTTTAAGCCCGTCGG + Intronic
1127740201 15:61896539-61896561 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1128326862 15:66729562-66729584 GCGTGGTGTTTTCAGCCGGTTGG + Intronic
1128853876 15:70990463-70990485 GCGCCGTTTTTTAAGCCCATCGG + Intronic
1129564649 15:76608848-76608870 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1129622019 15:77156326-77156348 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1129821850 15:78607885-78607907 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1129837471 15:78720132-78720154 GCGCCGTTTTTTAAACCAGTCGG - Intronic
1130197911 15:81798231-81798253 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1130382620 15:83383949-83383971 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1130818252 15:87464029-87464051 GCGCTGTTTTTTAAGCCTGTGGG - Intergenic
1130855641 15:87837191-87837213 GCGCCGTTTTTAAAGCCCGTTGG - Intergenic
1130947468 15:88559944-88559966 GCGCCATTTTTTAAGCCCGTGGG + Intergenic
1131014808 15:89049593-89049615 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131929104 15:97419152-97419174 GCGCCGTTTTTTAAGCCTGTAGG + Intergenic
1132254672 15:100365569-100365591 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1132260197 15:100417369-100417391 GCGCCATTTTTTAAGCCCGTCGG - Intronic
1134765119 16:16750866-16750888 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1134980935 16:18608345-18608367 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
1136647611 16:31635700-31635722 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1136992212 16:35160454-35160476 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1137001068 16:35231446-35231468 GCGCCGTTTTTTAAGCCCTTCGG + Intergenic
1137228221 16:46535651-46535673 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1137304259 16:47183057-47183079 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1138258933 16:55599083-55599105 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1138712292 16:58983209-58983231 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1138745933 16:59363504-59363526 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1138762850 16:59564997-59565019 GCGCCGTTTTTTAAGCCAGTCGG + Intergenic
1138796584 16:59976902-59976924 GTGCCGTTTTTTAAGCTGGTCGG - Intergenic
1138951515 16:61918603-61918625 GCACCGTTTTTTAAGCCCGTTGG - Intronic
1139040916 16:62998181-62998203 GCGCCGTTTTTTAAGCCCCTCGG + Intergenic
1139050587 16:63120255-63120277 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1139071460 16:63388375-63388397 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1140991786 16:80219996-80220018 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1141047321 16:80727385-80727407 GCGCCGTTTTTTAAGCCCCTCGG - Intronic
1141210752 16:81977655-81977677 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1141790927 16:86233595-86233617 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1145718391 17:27045329-27045351 GTGCCGTTTTTTAAGCCAGTCGG + Intergenic
1145724443 17:27104854-27104876 GCGCCGTTTTTCAAGCCCGTCGG + Intergenic
1146752496 17:35394239-35394261 GCGCTGTTTTTTAAGCCCGTTGG - Intergenic
1148953221 17:51332773-51332795 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1149059875 17:52409543-52409565 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1149408599 17:56380597-56380619 GCGCTGTTTTTTAAGCCTGTCGG - Intronic
1150818374 17:68413818-68413840 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1150879244 17:69004816-69004838 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1153429877 18:5004437-5004459 GCGGCGTTTTTTAAGCCCGTCGG - Intergenic
1155093094 18:22529938-22529960 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1155331033 18:24716523-24716545 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1155578811 18:27279850-27279872 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1155597948 18:27510310-27510332 GGGCCGTTTTTTAAGCCTGTCGG - Intergenic
1155898038 18:31353674-31353696 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1155986244 18:32233623-32233645 GCTCCGTTTTTTAAGCCCGTTGG + Intronic
1156115937 18:33787181-33787203 GCGCCATTTTTTAAGCCCGTTGG - Intergenic
1156158466 18:34331414-34331436 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1156344137 18:36240837-36240859 GCGCCGTTTTTTAAGCCCATCGG + Intronic
1156709348 18:39924671-39924693 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1157039762 18:44024503-44024525 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1157397336 18:47353932-47353954 GTGCCGTTTTTTAAGCCGGTCGG + Intergenic
1158074392 18:53511748-53511770 GCGCCGTTTTTTAAGCCCATTGG - Intronic
1158271481 18:55721206-55721228 GCACCGTTTTTTAAGCCTGTCGG + Intergenic
1158286837 18:55893116-55893138 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1158417317 18:57259998-57260020 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1158732110 18:60035385-60035407 GCACCGTTTTTTAAGCCTGTCGG + Intergenic
1158853067 18:61515204-61515226 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1159311414 18:66715375-66715397 GCTGCGTGTTTTAAGCCCGTGGG - Intergenic
1159466551 18:68790533-68790555 GCGCCGTTTTTCAAGCCCGTCGG + Intronic
1160274829 18:77421680-77421702 GCGCCGTTTTTTAAGCCCGTGGG + Intergenic
1162641028 19:12010492-12010514 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1163955408 19:20633615-20633637 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1164429883 19:28177884-28177906 GTGCCGTTTTTTAAGCCGGTCGG - Intergenic
1164552855 19:29226081-29226103 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1164978414 19:32593276-32593298 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1165010996 19:32846334-32846356 GCACCGTTTTTTAAGCCCGTTGG - Intronic
1165288145 19:34860489-34860511 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1166429763 19:42714669-42714691 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1166436888 19:42774788-42774810 GTGTCGTTTTTTAAGCCCATTGG + Intronic
1166489639 19:43247782-43247804 GCGCCCTTTTTTAAGCCCGTCGG + Intronic
1167500496 19:49844279-49844301 GCTTCTTGTTTTAAGCCACTCGG - Intergenic
925049363 2:799844-799866 GCGCCTTTTTTTAAGCCCGTCGG - Intergenic
925431675 2:3800072-3800094 GCGCCGTTTTTTAAGCCCGTTGG + Intronic
925470712 2:4158110-4158132 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
925512492 2:4643269-4643291 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
925963245 2:9038630-9038652 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
926338884 2:11887279-11887301 GTGTCGTTTGTTAAGCCTGTTGG + Intergenic
926403782 2:12527453-12527475 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
926507898 2:13738961-13738983 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
926595879 2:14789161-14789183 GTGCCGTTTTTTAAGCCTGTAGG + Intergenic
926755846 2:16235270-16235292 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
927048795 2:19306139-19306161 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
927334777 2:21909022-21909044 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
928628890 2:33170316-33170338 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
928765018 2:34635610-34635632 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
929295164 2:40238309-40238331 GGGCCGTTTTTTAAGCCCGTTGG + Intronic
929638355 2:43548697-43548719 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
929951989 2:46418770-46418792 GCAGCGTTTTTTAAGCCCGTTGG - Intergenic
930489093 2:52045229-52045251 TCGCCGTTTTTTAAGCCCGTTGG + Intergenic
930615295 2:53587323-53587345 GCGCCGTTTTTTAAGCCCGTGGG - Intronic
930800977 2:55442407-55442429 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
930835989 2:55793938-55793960 GCGCCATTTTTTAAGCCGGTCGG + Intergenic
930972902 2:57419008-57419030 GCATCGTTTTTTAAGCCGGTCGG - Intergenic
930987573 2:57609137-57609159 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
931048809 2:58387244-58387266 GCGCCGTTTTTTAAACCCGTCGG + Intergenic
931210452 2:60189325-60189347 GCGTCGTTTTTTAAGCTTGTTGG - Intergenic
931482051 2:62651420-62651442 GCTCCGTTTTTTAAGCCAGTCGG + Intergenic
931818670 2:65930019-65930041 GCGCCGTTTTTTAAGCCCATGGG + Intergenic
931843358 2:66177472-66177494 GTGCCGTTTTTTAAGCCTGTAGG - Intergenic
931846202 2:66206619-66206641 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
931887480 2:66632914-66632936 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
931977039 2:67654365-67654387 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
932478126 2:72021649-72021671 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
932483424 2:72064275-72064297 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
932642233 2:73460755-73460777 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
932644315 2:73485778-73485800 GCGCCGTTTTTTAAGCCGGTTGG + Intronic
932669172 2:73721697-73721719 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
932984373 2:76707785-76707807 ACGCCGTTTTTTAAGCCCGTCGG + Intergenic
933062347 2:77754052-77754074 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
933186803 2:79287952-79287974 GCGCTGTTTTTTAAGCCGGTCGG + Intronic
933499069 2:83089105-83089127 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
933519050 2:83347775-83347797 GCGCCGTTTTTTAAGCCCTTCGG - Intergenic
934693346 2:96379276-96379298 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
934806456 2:97231463-97231485 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
935631257 2:105214167-105214189 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
936036540 2:109117463-109117485 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
936554014 2:113477222-113477244 GCGCCTTTTTTTAAGCCCGTCGG + Intronic
936576031 2:113656447-113656469 GCGCCGTTTTTTAAGCCCGCAGG - Intergenic
936621456 2:114102131-114102153 GCGCCATTTTTTAAGCCGGTCGG + Intergenic
936929994 2:117778480-117778502 GCGCCGCTTTTTAAGCCCGTCGG - Intergenic
937457102 2:122051924-122051946 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
937592287 2:123629016-123629038 GCGCCGTTTTTAAAGCCCGTCGG - Intergenic
937658868 2:124408171-124408193 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
938659437 2:133470715-133470737 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
938808140 2:134825746-134825768 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
939837795 2:147151093-147151115 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
939890179 2:147727304-147727326 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
940085161 2:149850745-149850767 GCGCCGTTTTTTAAGCCCGCCGG - Intergenic
940401896 2:153257156-153257178 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
940414464 2:153403632-153403654 GCGCCGTTTTTCAAGCCGGTCGG + Intergenic
940573680 2:155472321-155472343 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
940608997 2:155966187-155966209 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
940632268 2:156254818-156254840 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
940680243 2:156776255-156776277 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
940695178 2:156968167-156968189 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
940741590 2:157515444-157515466 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
940820615 2:158351513-158351535 GCGCCGGTTTTTAAGCCGGTCGG - Intronic
941564314 2:167087646-167087668 GTGCCGTTTTTTAAGCCGGTCGG + Intronic
941611638 2:167668654-167668676 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
941626417 2:167835344-167835366 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
942056956 2:172193098-172193120 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
942197202 2:173532997-173533019 GCGCCGGTTTTTAAGCCCGTCGG + Intergenic
942400253 2:175594247-175594269 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
942415999 2:175759896-175759918 GCGCCTTATTTTAAGCCCGTCGG - Intergenic
942520305 2:176796720-176796742 GCGCCGTTTTTTAAGCCTGTGGG - Intergenic
942615315 2:177785698-177785720 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
942731660 2:179067002-179067024 GCGCGGTTTTTTAAGCCCGTTGG + Intergenic
942742505 2:179196244-179196266 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
943255781 2:185591586-185591608 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
943775554 2:191762149-191762171 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
943882934 2:193171006-193171028 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
943921304 2:193710611-193710633 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
944030449 2:195228737-195228759 GCGCTGTTTTTTAAGCCCGTTGG - Intergenic
944043180 2:195378922-195378944 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
944266151 2:197729252-197729274 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
945550821 2:211219621-211219643 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
945822682 2:214684070-214684092 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
945870432 2:215220550-215220572 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
946455118 2:219819335-219819357 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
947145917 2:227065175-227065197 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
947259562 2:228204983-228205005 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
947278856 2:228425705-228425727 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
947290487 2:228568560-228568582 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
947465608 2:230342196-230342218 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
947718840 2:232355540-232355562 GCGGCATTTTTTAAGCCCGTCGG - Intergenic
947887277 2:233583544-233583566 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
948039537 2:234888689-234888711 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
948235812 2:236389366-236389388 GCACCGTTTTTTAAGCCCGTCGG + Intronic
1169672171 20:8114596-8114618 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1169714559 20:8600804-8600826 GCGCCGTTTTTTAAGCCCGTTGG + Intronic
1170049775 20:12129383-12129405 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1170078726 20:12448820-12448842 GCGCCGTTTTTTAAGCCTGCTGG + Intergenic
1171466321 20:25330251-25330273 GTGCCGTTTTTTAAGCCAGTCGG - Intronic
1171569399 20:26233979-26234001 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1171910713 20:30949818-30949840 GTGTCGTTTTTTAAGCCCATTGG + Intergenic
1173156770 20:40619623-40619645 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1173346668 20:42206570-42206592 TCGCCGTTTTTTAAGCCCGTCGG - Intronic
1173774600 20:45693657-45693679 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1174790443 20:53472944-53472966 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1174928045 20:54782813-54782835 GCGTCATTTTTTAAGCCCATCGG - Intergenic
1176759758 21:10770053-10770075 GTGGCGTTTTTTAAGCCCGTGGG - Intergenic
1177273268 21:18875782-18875804 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1178593397 21:33931290-33931312 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1180504945 22:15985795-15985817 GTGCCGTATTTTAAGCTGGTGGG + Intergenic
1180519486 22:16184019-16184041 GCACCGTTTTTTAAGCCGGTCGG - Intergenic
1185424381 22:50757005-50757027 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1203333715 22_KI270739v1_random:36251-36273 GTGCCGTATTTTAAGCTGGTGGG - Intergenic
949154272 3:809677-809699 GCGTCGTTTTTTAAGCCCGTTGG - Intergenic
949406483 3:3719685-3719707 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
949666101 3:6341120-6341142 GCGCCGTTTTTTAAGCCCGCCGG - Intergenic
949678989 3:6490610-6490632 GCGAGGATTTTTAAGCCGGTCGG + Intergenic
949702032 3:6769841-6769863 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
949873933 3:8611826-8611848 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
949888779 3:8716378-8716400 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
950757376 3:15186966-15186988 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
950919199 3:16676917-16676939 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
951029005 3:17861072-17861094 GCGCCGTTTTTTAAGCCCGCCGG + Intronic
951071202 3:18330965-18330987 GCGTCATTTTTTAAGCCCGTCGG + Intronic
951086284 3:18516382-18516404 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
951101536 3:18693976-18693998 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
951124120 3:18963512-18963534 GCGCCGTTTTTTAAGCCGGTTGG + Intergenic
951125200 3:18976240-18976262 GCACCGTCTTTTAAGCCCGTCGG - Intergenic
951157809 3:19376303-19376325 GCGCCATTTTTGAAGCCGGTCGG + Intronic
951770011 3:26244889-26244911 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
951827187 3:26881662-26881684 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
951939231 3:28059543-28059565 GCGCCTTGTTTTAAGCCTGTCGG - Intergenic
952099426 3:29994217-29994239 GCGCCATTTTTTAAGCCCGTGGG - Intronic
952472582 3:33671754-33671776 GCGCCATTTTTTAAGCCTGTCGG - Intronic
952602659 3:35104213-35104235 GGGCCGTTTTTTAAGCCTGTGGG - Intergenic
952612300 3:35226117-35226139 GTGTCGTTTTTTAAGCCCATCGG - Intergenic
952630035 3:35454912-35454934 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
952659220 3:35824370-35824392 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
952936886 3:38405696-38405718 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
953000957 3:38932533-38932555 GCGCCATTTTTTAAGCCCGTCGG - Intronic
953133198 3:40160698-40160720 GCGCCATTTTTTAAGCCTGTCGG + Intronic
953214777 3:40908113-40908135 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
953289528 3:41648025-41648047 GCGCCATTTTTTAAGCCCGTCGG + Intronic
953513349 3:43566123-43566145 GCGCCATTTTTTAAGCCCGTCGG - Intronic
954497508 3:50978849-50978871 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
954518285 3:51199350-51199372 GTGTCGTTTTTTAAGCCCATCGG - Intronic
954548127 3:51456223-51456245 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
954890926 3:53927483-53927505 GCACCGTTTTTTAAGCCGGTCGG + Intergenic
954931353 3:54285246-54285268 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
954950095 3:54464603-54464625 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
955014161 3:55051809-55051831 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
955099371 3:55831917-55831939 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
955427438 3:58806880-58806902 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
955975536 3:64476096-64476118 GTGTCATTTTTTAAGCCCGTTGG - Intergenic
956265667 3:67393333-67393355 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
956461894 3:69481039-69481061 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
956537298 3:70290764-70290786 GCGCCGTTTTTTAAGCTTGTCGG + Intergenic
957034254 3:75279154-75279176 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
957101843 3:75837589-75837611 GCGCCATTTTTTAAGCCCGTTGG + Intergenic
957324486 3:78675479-78675501 GCGCCGTTTTTTAAGCCCATTGG - Intronic
957815280 3:85290226-85290248 GCGCCATTTTTTAAGCCGATCGG - Intronic
958155198 3:89747915-89747937 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
958171453 3:89944794-89944816 GCGCCGTTTTTCAAGCCTGTCGG + Intergenic
958210582 3:90468702-90468724 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
958512425 3:95065635-95065657 GCGCCGTTTTTTAAGCCCATTGG + Intergenic
958769227 3:98406876-98406898 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
958828875 3:99064497-99064519 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
958961023 3:100509906-100509928 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
959076406 3:101753732-101753754 GCACCGTTTTTTAAGCCCGTTGG + Intronic
959353393 3:105296523-105296545 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
959464192 3:106665595-106665617 GCGCTGTTTTTTAAGCCCGTTGG - Intergenic
959504674 3:107144389-107144411 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
959607484 3:108257980-108258002 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
959796784 3:110440386-110440408 GCGCCGTTTTTTAAGCCGGTAGG - Intergenic
959812700 3:110637728-110637750 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
959833171 3:110889113-110889135 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
959994426 3:112664843-112664865 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
960153782 3:114277193-114277215 GCGCCGTTTTTTAAGCCCATCGG - Intronic
960568762 3:119164801-119164823 GTGCCGTTTTTTAAGCCAGTTGG - Intronic
960715773 3:120573316-120573338 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
960753197 3:120979376-120979398 GCACCGTTTTTTAAGCCTGTCGG + Intronic
960839112 3:121938468-121938490 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
962004202 3:131331776-131331798 GCACCGTTTTTTAAGCCCGTCGG - Intronic
962104507 3:132376944-132376966 GCGCCGTGTTTTAAGCCTGTCGG + Intergenic
962138809 3:132766332-132766354 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
962238428 3:133729487-133729509 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
962394744 3:135005662-135005684 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
962397630 3:135030927-135030949 GCGCCATTTTTTAAGCCCGTCGG + Intronic
962424504 3:135257917-135257939 GCGCCGTGTTTTAAGCCTGTCGG + Intronic
962831729 3:139148012-139148034 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
963435232 3:145258313-145258335 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
963484393 3:145918197-145918219 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
963954818 3:151242061-151242083 GCCCCGTTTTTTAAGCCCGTCGG - Intronic
964325564 3:155542197-155542219 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
964399532 3:156284671-156284693 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
964552156 3:157897117-157897139 GCGCCGTTTTTTTAGCCCGTCGG - Intergenic
964688427 3:159423369-159423391 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
965100469 3:164291836-164291858 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
965194120 3:165572631-165572653 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
965228926 3:166026805-166026827 GCGCGGTTTTTTAAGCCCGTCGG + Intergenic
965323597 3:167275566-167275588 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
965382799 3:168011331-168011353 GCGCCGTTTTTTAATCCCGTCGG - Intronic
965717706 3:171625165-171625187 GCGCCATTTTTTAAGCCTGTTGG - Intronic
966082020 3:176016423-176016445 GCGCCGTGTTTTAAGCCCATCGG - Intergenic
966147410 3:176827339-176827361 GCGCCGTTTTTTAAGCCCTTTGG - Intergenic
966232259 3:177665009-177665031 GTGCCGTTTTTTAAGCCAGTTGG + Intergenic
966335188 3:178860249-178860271 GCGCCGTTTCTTAAGCCCGTCGG - Intergenic
966484139 3:180448774-180448796 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
967285250 3:187862782-187862804 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
967302155 3:188025086-188025108 GCGTTGTGAATTAAGCCAGTAGG - Intergenic
967361447 3:188636344-188636366 GCACCGTTTTTTAAGCCCGTCGG - Intronic
967397348 3:189022931-189022953 GCGCAGTTTTTTAAGCCCGTCGG + Intronic
967565345 3:190965222-190965244 GCGCCGTTTTTGAAGCCCGTCGG + Intergenic
967737193 3:192965330-192965352 GTGCCGTTTTTTAAGCCCGTGGG + Intergenic
967985010 3:195087973-195087995 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
969181304 4:5444305-5444327 GCACCGTTTTTTAAGCCCGTCGG + Intronic
969199798 4:5593882-5593904 GCGTCGTTTTTTAAGCCCTTCGG - Intronic
969222092 4:5767604-5767626 GAGCCGTTTTTTAAGCCCGTCGG + Intronic
969972931 4:11066628-11066650 GCTCCGTTTTTTAAGCCCGTTGG + Intergenic
970022321 4:11583213-11583235 GTGCCGTGTTTTAAGCCCGTTGG + Intergenic
970084840 4:12334846-12334868 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
970120602 4:12748571-12748593 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
970134134 4:12903727-12903749 GCGCCGTTTTTTCAGCCCGTTGG - Intergenic
970206958 4:13664934-13664956 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
970219868 4:13799279-13799301 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
970283230 4:14481050-14481072 GCGCCATTTTTTAAGCCGGTCGG - Intergenic
970299391 4:14666003-14666025 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
970358177 4:15278955-15278977 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
970611487 4:17729064-17729086 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
970623236 4:17848842-17848864 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
971116103 4:23647449-23647471 GCGCCTTTTTTTAAGCCCGTCGG + Intergenic
972119582 4:35683013-35683035 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
973124524 4:46567423-46567445 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
973183315 4:47294419-47294441 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
973311173 4:48711376-48711398 GCGCCGTTTTTTAAGCCCGTTGG - Intronic
973326766 4:48870410-48870432 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
973332455 4:48923559-48923581 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
973541548 4:51940787-51940809 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
973569528 4:52224055-52224077 GCGCCATATTTTAAGCCTGTCGG + Intergenic
973689409 4:53409819-53409841 GCGCCGTTTTTTAAGCCCATTGG + Intronic
973704160 4:53564936-53564958 GCGCCATTTTTTAAGCCCGTCGG - Intronic
973736574 4:53877418-53877440 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
974143597 4:57919349-57919371 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
974237988 4:59206754-59206776 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
974357990 4:60836975-60836997 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
974398711 4:61372932-61372954 GCGCCCTTTTTTAAGCCCGTCGG + Intronic
974418988 4:61646980-61647002 GCGCCGTTTTTTAAGCCGGTAGG + Intronic
974493880 4:62602577-62602599 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
974542125 4:63250682-63250704 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
974673191 4:65057878-65057900 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
974682021 4:65176889-65176911 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
974821153 4:67068199-67068221 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
975062439 4:70019353-70019375 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
975154824 4:71059534-71059556 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
975187378 4:71419524-71419546 GCCCCGTTTTTTAAGCCTGTCGG + Intronic
975531236 4:75401496-75401518 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
975535744 4:75448241-75448263 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
975824682 4:78307559-78307581 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
976025912 4:80687977-80687999 GCGCCGTTTTTTAAGCCCTTCGG - Intronic
976136101 4:81937603-81937625 GCGCCATTTTTTAAGCCCGTTGG + Intronic
976143672 4:82019861-82019883 GCGCCATTTTTTAAGCCCGTTGG - Intronic
976490755 4:85667327-85667349 GCGCCATTTTTTAAGCCCGTCGG + Intronic
976529423 4:86134973-86134995 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
976794731 4:88919860-88919882 GCGCCATTTTTTAAGCCCGTCGG - Intronic
976905148 4:90227910-90227932 GCGGCGTTTTTTAAGCCCGTCGG - Intronic
977157760 4:93594757-93594779 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
977264822 4:94841466-94841488 GCGCTGTTTTTTAAGCCGGTCGG + Intronic
977292235 4:95176946-95176968 GTGCCGTTTTTTAAGCCCGTGGG + Intronic
977333229 4:95664003-95664025 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
977391475 4:96414902-96414924 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
977485005 4:97633780-97633802 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
977492875 4:97736521-97736543 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
977505903 4:97903887-97903909 GCGCCATTTTTTAAGCCCGTTGG - Intronic
977516229 4:98023858-98023880 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
977619200 4:99117499-99117521 GCGACATTTTTTAAGCCCGTCGG + Intergenic
977678234 4:99771142-99771164 GCACCGTTTTTTAAGCCTGTCGG + Intergenic
977703718 4:100049160-100049182 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
977815685 4:101411374-101411396 GTGCCGTTTTTTAAGCCAGTCGG + Intronic
977818286 4:101441819-101441841 CAGTAGTGTTTTAAGCCGTTAGG + Intronic
977975205 4:103255969-103255991 GCGCCATTTTTTAAGCCAGTCGG + Intergenic
978216661 4:106213656-106213678 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
978418406 4:108503425-108503447 GCGCCGTTTTTTAAGTCTGTTGG - Intergenic
978599265 4:110411126-110411148 GCGCCGTTTTTTAAGCCAGTCGG + Intronic
978632534 4:110763311-110763333 GCGCTGTTTTTTAAGCCGGTCGG + Intergenic
978641521 4:110876499-110876521 GCGTCGTTTTTCAAGCCTGTCGG + Intergenic
978677498 4:111337243-111337265 GTGCCGTTTTTTAAGCTGGTCGG - Intergenic
978864809 4:113494844-113494866 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
979085565 4:116405998-116406020 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
979112838 4:116780737-116780759 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
979215753 4:118161701-118161723 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
979432501 4:120648164-120648186 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
979561915 4:122110394-122110416 GCGCCGTTTTTTAAGTTGGTCGG - Intergenic
980018150 4:127676911-127676933 GCGCCTTTTTTTAAGCCTGTTGG - Intronic
980426858 4:132636981-132637003 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
980507308 4:133739630-133739652 GCGCCGTTTTTTAAGCCAGTCGG + Intergenic
981059981 4:140413644-140413666 GCGCCGTTTTTTAAGCCTGTTGG - Intronic
981165200 4:141549603-141549625 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
981222503 4:142253642-142253664 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
981345018 4:143664917-143664939 GCACCGTTTTTTAAGCCCGTCGG + Intronic
981407767 4:144391856-144391878 GCGCCGTTTTTTAAGCCCCTCGG - Intergenic
981618060 4:146663587-146663609 GCGCCGTTTTTCAAGCCCGTCGG - Intergenic
981772262 4:148323583-148323605 GCGCCGTTTTTTCAGCCCGTCGG + Intronic
981899736 4:149848506-149848528 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
981905331 4:149915826-149915848 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
982052053 4:151511597-151511619 GCGCCGTTTTTTAAGCCCATGGG - Intronic
982581189 4:157180594-157180616 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
982801771 4:159715242-159715264 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
982838877 4:160157013-160157035 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
982870552 4:160574331-160574353 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
983066196 4:163212645-163212667 GCGCCGTTTTTTAAGCCCATTGG + Intergenic
983101583 4:163632534-163632556 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
983140330 4:164142109-164142131 GCGCTGTGTTTTAAGCCCGTTGG - Intronic
983148007 4:164241915-164241937 GCACCGTTTTTTAAGCCCGTTGG - Intronic
983370358 4:166850755-166850777 GCACCGTTTTTTAAGCCCGTCGG - Intronic
983385418 4:167055614-167055636 GCACCGTATTTTAAGCCCGTTGG - Intronic
983402417 4:167281838-167281860 GCATCGTTTTTTAAGCCTGTCGG + Intergenic
983704321 4:170639528-170639550 GTGTCGTTTTTTAAGCCCGTTGG - Intergenic
984044333 4:174778759-174778781 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
984063435 4:175020041-175020063 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
984198728 4:176692087-176692109 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
984307590 4:178015331-178015353 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
984696442 4:182784758-182784780 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
984857647 4:184208527-184208549 CCGCCGTTTTTTAAGCCCGTCGG - Intronic
985161648 4:187050804-187050826 GCGACATTTTTTAAGCCCGTCGG - Intergenic
985755249 5:1710116-1710138 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
986101482 5:4615727-4615749 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
986379627 5:7170850-7170872 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
986472481 5:8089913-8089935 GCGCCGTTTTTTAAGCCCCTGGG + Intergenic
987174377 5:15292233-15292255 GCGCCGTTTCTTAAGCCAGTCGG - Intergenic
987183956 5:15396425-15396447 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
987273282 5:16335710-16335732 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
988086008 5:26476338-26476360 GCGCTGTTTTTTAAGCCCGTTGG - Intergenic
988646588 5:33101724-33101746 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
988871567 5:35396388-35396410 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
989138078 5:38175206-38175228 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
989442945 5:41493765-41493787 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
989653389 5:43718252-43718274 GCGCCATTTTTTAAGCCAGTCGG - Intergenic
989725205 5:44579244-44579266 GCGCCTTTTTTTAAGCCCGTCGG - Intergenic
989798011 5:45499292-45499314 GCGCCGTTTTTTAAGACGGTTGG + Intronic
990030268 5:51251044-51251066 GCGCCATTTTTTAAGCTGGTTGG - Intergenic
990648434 5:57870565-57870587 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
990684702 5:58288351-58288373 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
990911895 5:60860691-60860713 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
991102122 5:62804676-62804698 GCGCCGTTTTGTAAGCCCGTCGG + Intergenic
991320717 5:65370563-65370585 GCGCCATTTTTTAAGCCCGTCGG - Intronic
991402131 5:66262690-66262712 GCGCCGTTTTTTAAGCCCTTCGG + Intergenic
991415543 5:66388445-66388467 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
991450987 5:66750583-66750605 GCGCCGTTTTTTAAGCCGGTCGG - Intronic
991542248 5:67742609-67742631 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
991545779 5:67780323-67780345 GCGCCGTTTTTTAAGCCCATGGG - Intergenic
991549245 5:67818235-67818257 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
991555410 5:67889906-67889928 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
992328970 5:75696000-75696022 GCGCCGTTTTTTAAGCCCCTCGG - Intronic
992514243 5:77475104-77475126 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
992525779 5:77608966-77608988 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
992620223 5:78585311-78585333 GCGCTGTTTTTTAAGCCCGTTGG + Intronic
992755597 5:79902597-79902619 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
993046502 5:82872565-82872587 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
993094216 5:83463501-83463523 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
993259294 5:85638749-85638771 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
993449111 5:88052631-88052653 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
993612591 5:90073529-90073551 GCGCTGTTTTTTAAGCCGGTTGG - Intergenic
993663608 5:90668314-90668336 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG + Intronic
993758453 5:91762435-91762457 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
993790249 5:92199172-92199194 GCGCCGTGTTTTAAGCCCGTCGG + Intergenic
993798759 5:92302663-92302685 GTGCCATGTTTTAAGCCCGTCGG + Intergenic
993871663 5:93261337-93261359 GCGCCGTTTCTTAAGCCTGTCGG - Intergenic
993925226 5:93857614-93857636 GCGCCGTATTTTAAGCCCGTCGG + Intronic
994249504 5:97519621-97519643 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
994270656 5:97772306-97772328 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
994405983 5:99345447-99345469 GCGCCCTTTTTTAAGCCCGTCGG + Intergenic
994492461 5:100463976-100463998 GCACCGTTTTTTAAGCCCGTAGG + Intergenic
994547045 5:101180432-101180454 GCGCCTTTTTTTAAGCCCGTCGG - Intergenic
994780261 5:104080062-104080084 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
995203028 5:109447321-109447343 GCGCCATTTTTTAAGCCAGTCGG + Intergenic
995334731 5:110986032-110986054 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
995343946 5:111090586-111090608 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
995413172 5:111881138-111881160 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
995423367 5:111991793-111991815 GCGCCGTTTTTTAAGCCCATCGG + Intronic
995570214 5:113471987-113472009 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
995923744 5:117343966-117343988 GCGCCATTTTTTAAGCCCGTGGG + Intergenic
995937443 5:117533305-117533327 GCGCCGTTTTTTATGCCCGTTGG + Intergenic
996130980 5:119780467-119780489 GCGACGTTTTTTAAGCCCGTCGG + Intergenic
996158537 5:120132705-120132727 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
996162433 5:120181852-120181874 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
996419111 5:123242312-123242334 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
996751750 5:126896013-126896035 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
996813349 5:127544709-127544731 GCGCTGTTTTTTAAGCCTGTTGG + Intronic
996830954 5:127739634-127739656 GCTCCGTTTTTTAAGCCTGTCGG + Intergenic
996832233 5:127752817-127752839 GCGCCGTTTTTTAAGCCGGTTGG + Intergenic
996881291 5:128299526-128299548 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
997087422 5:130818036-130818058 GCGCCGTGTTTTAAGCCCGTCGG - Intergenic
997184837 5:131871316-131871338 GTGCCGTTTTTTAAGCCAGTTGG - Intronic
997919914 5:137968897-137968919 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
998760246 5:145424440-145424462 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
998982651 5:147721553-147721575 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
999003280 5:147946816-147946838 GCGCCGTTTTTTAAGCCCGACGG + Intergenic
999025812 5:148230901-148230923 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
999033475 5:148320278-148320300 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
999555816 5:152741236-152741258 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
999612155 5:153381681-153381703 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
999815165 5:155168639-155168661 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1000377103 5:160592726-160592748 GCGCCATTTTTTAAGCCTGTTGG - Intronic
1000424160 5:161071652-161071674 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1000468721 5:161611761-161611783 GCGCCGTTTTTTAAGCCAGTCGG + Intronic
1000500032 5:162036629-162036651 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1000540338 5:162531358-162531380 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1001737670 5:174020089-174020111 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1001898061 5:175398070-175398092 GTGACGTTTTTTAAGCCCGTCGG - Intergenic
1002011118 5:176282260-176282282 GCGCCCTTTTTTAAGCCCGTCGG + Intronic
1202773483 5_GL000208v1_random:35592-35614 GCGCCGATTTTTAAGCCGGTCGG + Intergenic
1202775185 5_GL000208v1_random:63150-63172 GCACCGTTTTTTAAGCCTGTCGG + Intergenic
1002904021 6:1434427-1434449 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1003239819 6:4334438-4334460 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1003414003 6:5892094-5892116 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1003446616 6:6190928-6190950 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1003457877 6:6300446-6300468 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1003726974 6:8776196-8776218 GCGCTGTTTTTTAAGCCGGTCGG + Intergenic
1003813433 6:9811051-9811073 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1004303628 6:14480274-14480296 GCGCAGTTTTTTAAGCCTGTCGG - Intergenic
1004809756 6:19247250-19247272 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1005239163 6:23804346-23804368 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1005723032 6:28621532-28621554 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1005884494 6:30086309-30086331 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1007858707 6:44884927-44884949 GCGCCGTTTTTTAAGCCCATTGG - Intronic
1007974424 6:46086073-46086095 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1008212052 6:48737645-48737667 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1008262739 6:49387182-49387204 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1008472126 6:51895955-51895977 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1008635419 6:53405902-53405924 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1008769478 6:54961724-54961746 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1008801115 6:55369146-55369168 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1008968080 6:57335149-57335171 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1009060628 6:58394101-58394123 GCACCGTTTTTTAAGCCTGTCGG - Intergenic
1009341057 6:62555373-62555395 GCGCCGTTTTTTAAGCCAGTCGG - Intergenic
1009499180 6:64390061-64390083 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1009829528 6:68912873-68912895 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1009875083 6:69495663-69495685 GCGCCGTTTTTTAAGCTGGTTGG - Intergenic
1009984988 6:70771580-70771602 GCACCGTTTTTTAAGCCCGTCGG + Intronic
1010031030 6:71270809-71270831 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1010263343 6:73841114-73841136 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1010460734 6:76111319-76111341 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1010589923 6:77700419-77700441 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1010695710 6:78971816-78971838 GCGCCGTTTTTTAAGCCCATTGG - Intronic
1010834854 6:80573623-80573645 GCGCTGTTTTTTAAGCCCGTAGG + Intergenic
1010956991 6:82101600-82101622 GTGCCGTTTTTTAAGCCAGTCGG - Intergenic
1010983421 6:82395103-82395125 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
1010998312 6:82558701-82558723 GCACCGTTTTTTAAGCCGGTCGG - Intergenic
1011107940 6:83803447-83803469 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1011379893 6:86731690-86731712 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
1011397113 6:86921467-86921489 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
1011435204 6:87328956-87328978 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1011538668 6:88406796-88406818 CCGCCGTGTTTTAAGCCCGTCGG - Intergenic
1011550426 6:88527027-88527049 GCGCCATCTTTTAAGCCCGTTGG + Intergenic
1011804257 6:91052847-91052869 GCACCGTTTTTTAAGCCGGTCGG + Intergenic
1012094562 6:94942434-94942456 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1012151353 6:95758686-95758708 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1012285452 6:97382383-97382405 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1012387922 6:98703357-98703379 GCGCCATTTTTTAAGCCGGTCGG - Intergenic
1012540344 6:100355003-100355025 GCGCCGGTTTTTAAGCCTGTCGG - Intergenic
1012680156 6:102169963-102169985 GCGCCGTTTTTTAAGCCAGTCGG - Intergenic
1012719368 6:102722405-102722427 GCATCGTTTTTTAAGCCCGTTGG - Intergenic
1012876775 6:104737616-104737638 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1013197726 6:107860423-107860445 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
1013868437 6:114726430-114726452 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1013886695 6:114976081-114976103 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1014076802 6:117245052-117245074 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1014120663 6:117721597-117721619 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1014185211 6:118427108-118427130 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1014373622 6:120643325-120643347 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1014381503 6:120748653-120748675 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1014605782 6:123472369-123472391 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1014674655 6:124348909-124348931 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1014702965 6:124712522-124712544 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1014704173 6:124725995-124726017 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1014849721 6:126326900-126326922 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1014876996 6:126673854-126673876 GCGCCATTTTTTAAGCCGGTCGG - Intergenic
1015056711 6:128911341-128911363 TCGCCGTTTTTTAAGCCCGTCGG + Intronic
1015432513 6:133147784-133147806 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1015677965 6:135771189-135771211 GTGCCGTTTTTTAAGCCGGTCGG + Intergenic
1016231802 6:141815116-141815138 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1016244946 6:141969829-141969851 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1017394291 6:153979221-153979243 GCCCCGTTTTTTAAGCCCGTCGG - Intergenic
1018126242 6:160685428-160685450 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1018525776 6:164708581-164708603 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1019752906 7:2743839-2743861 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
1020449315 7:8303819-8303841 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1020454092 7:8352034-8352056 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1020486992 7:8732045-8732067 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1020779265 7:12497522-12497544 GCACCGTTTTTTAAGCCCGTGGG - Intergenic
1020881311 7:13765944-13765966 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1020884683 7:13806567-13806589 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1020924952 7:14313570-14313592 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
1021047396 7:15940529-15940551 GCGCCGTTTTTTAAGCCCCTCGG - Intergenic
1021082808 7:16383824-16383846 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1021302618 7:18990752-18990774 GCGCCGTTTTTTAAGCCCGTAGG + Intronic
1021373888 7:19883472-19883494 GAGCCGTTTTTTAAGCCCGTGGG + Intergenic
1021618622 7:22528597-22528619 GCACCGTTTTTTAAGCCGGTTGG - Intronic
1021701242 7:23321360-23321382 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1021947703 7:25744133-25744155 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1022142794 7:27507877-27507899 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1022464287 7:30642511-30642533 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1022586676 7:31619919-31619941 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1022630751 7:32082174-32082196 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1022672056 7:32464838-32464860 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1022694188 7:32688395-32688417 GGGCCGTTTTTTAAGCCCGTCGG + Intergenic
1022696189 7:32708306-32708328 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1022824398 7:33994324-33994346 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
1022845488 7:34205945-34205967 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1022874414 7:34513757-34513779 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1023147772 7:37169169-37169191 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1023194339 7:37617752-37617774 GCGCCTTTTTTTAAGCCCGTCGG + Intergenic
1024092196 7:45953104-45953126 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1024461674 7:49666049-49666071 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1024699351 7:51890208-51890230 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG + Intergenic
1025213671 7:57036833-57036855 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1025658283 7:63539984-63540006 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1027292420 7:76728784-76728806 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1027639243 7:80713407-80713429 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1027892553 7:83995020-83995042 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1027896819 7:84055408-84055430 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1027897351 7:84062707-84062729 GCGCCGTTTTTTAAGCCCGCCGG - Intronic
1027903579 7:84150528-84150550 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1027982954 7:85250155-85250177 GCGCCATTTTTTAAGCCTGTCGG - Intergenic
1027989235 7:85335421-85335443 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1028119337 7:87040058-87040080 GCGCCGTGTTTTAAGCCCGTCGG - Intronic
1028252850 7:88556743-88556765 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1028421681 7:90639948-90639970 GCGCCGGTTTTTAAGCCCGTAGG + Intronic
1028499812 7:91507039-91507061 GCGCCGTTTTTTAAGCCTGTAGG - Intergenic
1028537837 7:91909387-91909409 GCGCGGTTTTTTAAGCCGGTCGG + Intergenic
1028665770 7:93342265-93342287 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1028686238 7:93591448-93591470 GCGCCGTTTTTCAAGCCTGTCGG + Intergenic
1028946457 7:96585671-96585693 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
1029036999 7:97532862-97532884 GAGCCGTTTTTTAAGCCTGTCGG - Intergenic
1029313136 7:99686322-99686344 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1029922138 7:104276827-104276849 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1029949036 7:104563386-104563408 GCACCGTTTTTTAAGCCCGTCGG + Intronic
1030753722 7:113263402-113263424 GCGCCTTTTTTTAAGCCTGTCGG + Intergenic
1030775873 7:113533640-113533662 GCGCCATTTTTTAAGCCTGTAGG - Intergenic
1031000434 7:116409160-116409182 GCGCCGTCTTTTAAGCTTGTCGG - Intronic
1031266326 7:119587007-119587029 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1031477300 7:122238822-122238844 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1031579213 7:123450890-123450912 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1031585462 7:123528019-123528041 CCGCCGTTTTTTAAGCCTGTCGG + Intronic
1031617119 7:123894799-123894821 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1031706379 7:124985167-124985189 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1032004788 7:128292314-128292336 GCGAGGTTTTTTAAGCCCGTTGG - Intergenic
1032289626 7:130577456-130577478 GGGCTGTTTTTTAAGCCGGTCGG - Intronic
1032972519 7:137181910-137181932 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1032993926 7:137424700-137424722 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1033401787 7:141032905-141032927 TCGACGTTTTTTAAGCCCGTCGG - Intergenic
1033623817 7:143088581-143088603 GTGTCGTTTTTTAAGCCCATTGG - Intergenic
1034369260 7:150580298-150580320 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1034382117 7:150706539-150706561 GCGCTGTTTTTTAAGCCTGTTGG - Intergenic
1036021843 8:4854701-4854723 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1036129098 8:6091611-6091633 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1037082426 8:14803516-14803538 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1037145022 8:15561708-15561730 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1037232016 8:16670419-16670441 GGGCCGTTTTTTAAGCCGGTCGG - Intergenic
1037546678 8:19930463-19930485 GTGCCGTTTTTTAAGCCCGTTGG - Intronic
1038107692 8:24454482-24454504 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1038902293 8:31857316-31857338 GCGCTGTTTTTTAAGCCGGTTGG + Intronic
1039127044 8:34215235-34215257 GCACCGTTTTTTAAGCCCGTTGG - Intergenic
1039423013 8:37460582-37460604 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1040062315 8:43114439-43114461 GTGCCGTTTTTTAAGCCCGTGGG + Intronic
1040078687 8:43266277-43266299 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1040405789 8:47100658-47100680 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
1040411445 8:47158540-47158562 GCGCCATCTTTTAAGCCCGTCGG - Intergenic
1040865707 8:52047164-52047186 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1041203762 8:55476708-55476730 GTGTCATTTTTTAAGCCTGTTGG - Intronic
1041301412 8:56415523-56415545 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1041371379 8:57164335-57164357 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1041485373 8:58370459-58370481 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1041557503 8:59174357-59174379 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1041637526 8:60160665-60160687 GCGACGTTTTTTAAGCCCATTGG - Intergenic
1041736950 8:61121077-61121099 GCGCCGTTTTTTAAGCCCGTGGG + Intronic
1041817785 8:61994603-61994625 GCGCCGTTTTTTAAGCCCATGGG - Intergenic
1041885270 8:62800928-62800950 GCACCGTTTTTTAAGCCCGTTGG - Intronic
1041949980 8:63490014-63490036 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1042010554 8:64240395-64240417 GCACCGTGTTTTAAGCCCGTTGG - Intergenic
1042457196 8:69019306-69019328 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1042476515 8:69254519-69254541 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1042987409 8:74599931-74599953 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1043009728 8:74866820-74866842 TTGCCGTTTTTTAAGCCGGTCGG - Intergenic
1043042342 8:75278668-75278690 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1043119767 8:76308408-76308430 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1043181235 8:77088712-77088734 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1043241520 8:77940811-77940833 GAGCCGTTTTTTAAGCCCGTCGG - Intergenic
1043409866 8:79982576-79982598 GCGCCGTTTTTTAAGACCGTCGG - Intronic
1043555632 8:81427513-81427535 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1043791237 8:84469843-84469865 GCGCTGTTTTTTAAGCCCGTCGG + Intronic
1044030459 8:87228944-87228966 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1044045448 8:87426022-87426044 GCACCGTTTTTTAAGCCCGTCGG + Intronic
1044209625 8:89535531-89535553 GCGCGGTTTTTTAAGCCCGTCGG - Intergenic
1044284856 8:90399208-90399230 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1044353877 8:91197547-91197569 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1044409789 8:91869813-91869835 GCGCCGTTTTTGAAGCCTGTCGG - Intergenic
1044453929 8:92369886-92369908 GCGCCGTTTTTTAAGCCCTTCGG + Intergenic
1044883060 8:96744180-96744202 TCGCCGTTTTTTAAGCCAGTCGG + Intronic
1044909835 8:97045316-97045338 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1044968351 8:97595406-97595428 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1045044416 8:98260566-98260588 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1045083145 8:98650651-98650673 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
1045293419 8:100852624-100852646 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1045386751 8:101678370-101678392 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1045433163 8:102133052-102133074 GCGCCGTTTTTTAAGCCCGTGGG - Intergenic
1045607055 8:103788975-103788997 GCGCCGTTTTTTAAGCCCTTCGG + Intronic
1045775267 8:105794910-105794932 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1045954975 8:107895584-107895606 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1046433877 8:114163027-114163049 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1046464701 8:114586050-114586072 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1046468514 8:114636994-114637016 GTGCTGTTTTTTAAGCCGGTCGG + Intergenic
1046554020 8:115753463-115753485 GCGCCATTTTTTAAGCCCGTCGG - Intronic
1046896558 8:119479573-119479595 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1047070172 8:121334495-121334517 TCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1047077271 8:121418173-121418195 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1047579618 8:126199705-126199727 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1047592494 8:126341884-126341906 GCGCCGTTTTTTAAGCCCTTCGG - Intergenic
1047837922 8:128714652-128714674 GCGCCGTTTTTTAAGCCGGTCGG - Intergenic
1047840325 8:128744914-128744936 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1048093123 8:131262397-131262419 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1048125902 8:131635468-131635490 GCCCCGTTTTTTAAGCCCGTGGG - Intergenic
1048626963 8:136195899-136195921 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1048697155 8:137040799-137040821 GCACCGTTTTTTAAGCCTGTCGG + Intergenic
1048785719 8:138048263-138048285 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1048792483 8:138116465-138116487 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1049898988 9:139950-139972 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1049907859 9:235728-235750 GTGCCGTTTTTTAAGCCCGTTGG + Intronic
1050047104 9:1558734-1558756 GTGCCGGTTTTTAAGCCGGTTGG - Intergenic
1050048553 9:1574724-1574746 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1050337777 9:4606099-4606121 GCGCCATTTTTTAAGCCCGTAGG - Intronic
1050509222 9:6376566-6376588 GTGCTGTTTTTTAAGCCGGTCGG - Intergenic
1051005077 9:12334294-12334316 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1051223635 9:14876507-14876529 GCGCCATGTTTTAAGCCCGTCGG + Intronic
1051299013 9:15628340-15628362 GCGCCGTTTTTTAAGCCCGTCGG - Intronic
1051479074 9:17539861-17539883 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
1051537641 9:18178314-18178336 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1051584376 9:18711534-18711556 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1051598005 9:18844867-18844889 GTGCCGTTTTTTAAGCCTGTCGG + Intronic
1051778107 9:20658482-20658504 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1051917560 9:22226161-22226183 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1052083039 9:24230354-24230376 GCGGCGTTTTTTAAGCCTGTCGG + Intergenic
1052373363 9:27690819-27690841 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1052513429 9:29450694-29450716 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1052701055 9:31938059-31938081 GCGCCGTTTTTTAAGCCCCTCGG + Intergenic
1052718799 9:32149374-32149396 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1052775585 9:32729318-32729340 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1053030016 9:34767533-34767555 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1053038825 9:34851430-34851452 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1054345785 9:63913681-63913703 GCACCGTGTTTTAAGCCAGTTGG - Intergenic
1054347303 9:63980062-63980084 GCGCCGTTTTTCAAGCCCGTCGG - Intergenic
1054445032 9:65306404-65306426 GCGCCGTTTTTCAAGCCCGTCGG - Intergenic
1054485240 9:65715102-65715124 GCGCCGTTTTTCAAGCCCGTCGG + Intronic
1055632182 9:78236069-78236091 GCGCCGGGATTCAAGCCGGTGGG - Intronic
1055721792 9:79182971-79182993 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1055745442 9:79439261-79439283 GCGCCGTTTTTTAAGGCCGTCGG - Intergenic
1055827527 9:80345180-80345202 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1055860836 9:80747370-80747392 GAGCCGTTTTTTAAGCCCGTCGG + Intergenic
1055918477 9:81432594-81432616 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1056049921 9:82757543-82757565 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1056051594 9:82775052-82775074 TCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1056284822 9:85077366-85077388 GCACCGTTTTTTAAGCCCGTTGG + Intergenic
1056416644 9:86383303-86383325 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1056440029 9:86611740-86611762 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1056484508 9:87042176-87042198 GCGCCGTTTTTTAAGCCAGTCGG - Intergenic
1056973688 9:91231253-91231275 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1057086420 9:92214709-92214731 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1057322370 9:94026172-94026194 GTGCCGTTTTTTAAGCCCGTCGG + Intergenic
1057728416 9:97586709-97586731 GCGCCATTTTTTAAGCCCGTCGG + Intronic
1057844106 9:98508580-98508602 GCGCCATTTTTTAAGCCCGTTGG - Intronic
1058063863 9:100527528-100527550 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1058215165 9:102223611-102223633 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1058290759 9:103237786-103237808 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1058557691 9:106187321-106187343 GCGCCGTTTTTTAAGCCGGTTGG + Intergenic
1059921962 9:119169418-119169440 GCGCCGTTTTTTAAGCCCGCCGG - Intronic
1060615615 9:125010343-125010365 GCACCGTTTTTTAAGCCCGTCGG - Intronic
1061833274 9:133310313-133310335 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1203443671 Un_GL000219v1:34401-34423 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1203408065 Un_KI270538v1:66200-66222 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1203514479 Un_KI270741v1:153310-153332 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1186041151 X:5480755-5480777 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1186243349 X:7593432-7593454 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1186805620 X:13138154-13138176 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1186905829 X:14109653-14109675 GCGCTGTTTTTTAAGCCCGTCGG + Intergenic
1186968008 X:14809492-14809514 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1187113127 X:16321949-16321971 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1187223065 X:17348194-17348216 GCTCCGTGTTTTAAGCCCGTTGG + Intergenic
1187602296 X:20845746-20845768 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1187645199 X:21339766-21339788 GCACCGTTTTTTAAGCCTGTCGG - Intergenic
1188658597 X:32731199-32731221 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1188791934 X:34415449-34415471 GCGCGGTTTTTTAAGCCCGTCGG - Intergenic
1188959309 X:36470894-36470916 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1189049968 X:37634262-37634284 GCGCCGTTTTTTAAGCCCGTTGG + Intronic
1189542275 X:42004599-42004621 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
1189562735 X:42207861-42207883 GGGCCGTTTTTTAAGCCCGTCGG + Intergenic
1189583317 X:42430570-42430592 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1190519433 X:51262321-51262343 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1190536462 X:51433276-51433298 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1190593231 X:52026268-52026290 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1190975529 X:55396816-55396838 GCGCCGTTTTTTAAGCCCATTGG - Intergenic
1190977998 X:55426834-55426856 GTGCCGTTTTTTAAGCCAGTTGG - Intergenic
1191020254 X:55851594-55851616 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1191050305 X:56184184-56184206 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1191266206 X:58396912-58396934 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1191564999 X:62517402-62517424 GCGCCGTTTTTTAAGCCCCTCGG - Intergenic
1191649305 X:63519422-63519444 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1191656312 X:63602899-63602921 GCGCCGTGTCTTAAGCCCGTCGG + Intergenic
1191708120 X:64115709-64115731 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1191814109 X:65224686-65224708 GTGCCGTTTTTTAAGCCCGTCGG - Intergenic
1191935850 X:66426554-66426576 GCGCCGTTTTTTAAGCTGGTGGG - Intergenic
1192015617 X:67326813-67326835 GCACCGTTTTTTAAGCCCGTCGG + Intergenic
1192096459 X:68217216-68217238 GCTCCGTTTTTTAAGCCCGTCGG - Intronic
1192280772 X:69682525-69682547 GCGCCGTTTTTTAAGCCCCTCGG + Intronic
1192598900 X:72440845-72440867 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1192668773 X:73117210-73117232 GCGCCGTTTTTTAAGCGCGTCGG - Intergenic
1192835502 X:74794680-74794702 GCGCCTTTTTTTAAGCCCGTCGG + Intronic
1192843187 X:74878693-74878715 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1192855015 X:74999847-74999869 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1192871487 X:75188727-75188749 GCCCCGTTTTTTAAGCCCGTCGG + Intergenic
1192876218 X:75232227-75232249 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1192907494 X:75566980-75567002 GTGGCGTTTTTTAAGCCCGTCGG + Intergenic
1192909355 X:75586805-75586827 GCGGCGTTTTTTAAGCCCGTCGG - Intergenic
1193015298 X:76725735-76725757 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1193045220 X:77046528-77046550 GCGCCGTGTTTTAAGCCGGTCGG - Intergenic
1193064469 X:77244569-77244591 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1193426415 X:81345584-81345606 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1193620814 X:83750799-83750821 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1193783663 X:85733910-85733932 GCGCCGTTTTTTAAGCCCGTGGG - Intergenic
1193896099 X:87116608-87116630 GCGCCATTTTTTAAGCCGGTCGG - Intergenic
1193983052 X:88208187-88208209 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1194271854 X:91825379-91825401 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1194417088 X:93627627-93627649 GCGCTGTTTTTTAAGCCCGTTGG - Intergenic
1194441530 X:93940043-93940065 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1194516552 X:94862675-94862697 GCGCCATTTTTTAAGCCCGTCGG - Intergenic
1194570519 X:95549585-95549607 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1194736191 X:97515214-97515236 GCACCGTTTTTTAAGCCCGTCGG + Intronic
1194803554 X:98300642-98300664 GCGCTGTTTTTTAAGCCCGTCGG - Intergenic
1194951743 X:100135239-100135261 GCGCCGTTTTTTAAGCCCATCGG - Intergenic
1195233718 X:102877003-102877025 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1195421253 X:104677800-104677822 GCGCCGTTTTTTAAGCTCGTCGG + Intronic
1195517802 X:105797208-105797230 GCACCGTTTTTTAAGCCCGTCGG - Intergenic
1195659598 X:107364636-107364658 ACGCCGTTTTTTAAGCCGGTCGG - Intergenic
1195886561 X:109644959-109644981 GCACCGTTTTTTAAGCCTGTCGG - Intronic
1195983640 X:110606130-110606152 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG + Intergenic
1196241038 X:113343532-113343554 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
1196348740 X:114700871-114700893 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
1196350762 X:114726219-114726241 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1196359576 X:114836410-114836432 GCGCCGTTTTTTAAGCCGGTCGG + Intronic
1196380716 X:115086288-115086310 GTGCCGTTTTTTAAGCCCGTTGG + Intergenic
1196511791 X:116520314-116520336 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1196544574 X:116946977-116946999 GCGCCGTGTTTGAAGCCGGTCGG + Intergenic
1196570479 X:117260976-117260998 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
1196615523 X:117763006-117763028 GCGCCATTTTTTAAGCCCGTCGG + Intergenic
1196638474 X:118032029-118032051 GCGCTGTTTTTTAAGCCCGTCGG - Intronic
1197000868 X:121437945-121437967 GCGCCGTGTTTTAAGCCCGTCGG - Intergenic
1197008936 X:121537037-121537059 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1197370025 X:125614647-125614669 GCGCCGTTTTTTAAGCCGGTCGG + Intergenic
1197410518 X:126109827-126109849 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1197420817 X:126235160-126235182 GCGCCGTTTTTTAAGCCCATTGG + Intergenic
1197502245 X:127256170-127256192 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1197624099 X:128782955-128782977 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1197648995 X:129044519-129044541 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1197859911 X:130959232-130959254 GCGCCGTTTTTTAAGCCCCTCGG - Intergenic
1197877777 X:131128923-131128945 GCGCCGGTTTTTAAGCCCGTCGG + Intergenic
1197880139 X:131157973-131157995 GCGCAGTTTTTTAAGCCCGTCGG + Intergenic
1197902058 X:131384047-131384069 GCGCTGTTTTTTAAGCCGGTCGG + Intronic
1197919664 X:131578978-131579000 GCGCCGTTTTTTAAGCCCGTCGG - Intergenic
1197927692 X:131664253-131664275 GCGCTGTTTTTTAAGCCGGTCGG - Intergenic
1197975444 X:132161838-132161860 GCGCCGTTTTTTAAGCCCGTGGG + Intergenic
1198418565 X:136445978-136446000 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1198643194 X:138778604-138778626 GTGCCGTTTTTTAAGCCTGTCGG - Intronic
1198980659 X:142391300-142391322 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1199379180 X:147147843-147147865 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1199465323 X:148129154-148129176 TCGCCGTGTTTTAAGCCCGTCGG + Intergenic
1199587933 X:149436115-149436137 GCGCCATTTTTTAAGCCGGTCGG - Intergenic
1199705436 X:150421140-150421162 GCGCCGTGTTTTAAGCCCGTGGG + Intronic
1199933098 X:152544820-152544842 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
1200321853 X:155197921-155197943 GCGCCGTTTTTTAAGCCCATCGG - Intronic
1200331738 X:155305278-155305300 GCGCCGTTTTTTAAGCCCGCCGG + Intronic
1200357592 X:155568148-155568170 GCGCCGTTTTTTCAGCCTGTCGG - Intronic
1200583018 Y:4973538-4973560 GCGCCGTTTTTTAAGCTCGTGGG - Intergenic
1200589105 Y:5046816-5046838 GCGCCGTTTTTTAAGCCCGTCGG + Intronic
1200785243 Y:7255253-7255275 GCGCCGTTTTTTAAGCCCATCGG + Intergenic
1200874620 Y:8140024-8140046 GCGCCGTTTTTTAAGCCCGTCGG + Intergenic
1201441431 Y:14012828-14012850 GCGCCGTTTTTTAAGCCCGTTGG - Intergenic
1201443139 Y:14029879-14029901 GCGCCGTTTTTTAAGCCCGTTGG + Intergenic
1201450092 Y:14102437-14102459 GTGCCGTTTTTTAAGCCCGTTGG - Intergenic
1201545628 Y:15158730-15158752 GCACCGTCTTTTAAGCCTGTCGG + Intergenic
1201600951 Y:15728023-15728045 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1201614820 Y:15885735-15885757 GAGCCGTTTTTTAAGCCCGTCGG - Intergenic
1201899563 Y:19034928-19034950 GCTCCGTTTTTTAAGCCCGTCGG - Intergenic
1201954934 Y:19613292-19613314 GCGCTGTTTTTTAAGCCTGTTGG - Intergenic
1202012981 Y:20368292-20368314 GCTCCGTTTTTTAAGCCCGTCGG - Intergenic
1202072973 Y:21011616-21011638 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1202077673 Y:21053470-21053492 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1202200795 Y:22345322-22345344 GCGCCGTTTTTTAAACCCGTCGG + Intronic
1202277939 Y:23144968-23144990 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1202287264 Y:23263799-23263821 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1202430765 Y:24776307-24776329 GTGCCGTTTTTTAAGCCCGTCGG - Intronic
1202439204 Y:24881856-24881878 GTGCCGTTTTTTAAGCCCGTCGG + Intronic
1202577174 Y:26340035-26340057 GCGCCATTTTTTAAGCCCGTCGG - Intergenic